skfC

skfC
168

may be involved in spore killing

locus
BSU_01935
Molecular weight
56.00 kDa
pI
8
Protein length
Gene length
function
may be involved in spore killing
product
unknown
essential
no
synonyms
skfC, ybcS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
215,404  216,894
Expression and Regulation
Operons
genes
[gene|DDB0022F50999AC52809D651C9CC5A5FDC71302C|skfA]-[gene|F981C605C652D1A4429579A5F24608CE7F570834|skfB]-[gene|4DFF9924E07D834F37580D73E88451C1671C5111|skfC]-[gene|5886364199844356446C08F08664B301A714E74A|skfE]-[gene|77D93CAEF46EBBB9BAF570714445E194D5F2884E|skfF]-[gene|527AB8EAAF0A1AAD4E5B714B35ED9F78BECC17EC|skfG]-[gene|F31B12F80AFC3580FD33811A1C22E74F75DC1A85|skfH]
description
[Pubmed|16816204]
regulation
expressed under conditions that trigger sporulation ([wiki|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/14651647,15687200 PubMed]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [PubMed|14651647,15687200], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [PubMed|15687200,17720793], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|16816204], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16452424], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
Northern blotting during during phosphate limitation showed an intense 0.25 kb '[protein|search|skfA]'-specific transcript, and a weaker 6.5 kb '[protein|search|skfA]-[protein|search|skfB]-[protein|search|skfC]-[protein|search|skfE]-[protein|search|skfF]-[protein|search|skfG]-[protein|search|skfH]' transcript.
Open in new tab

[gene|DDB0022F50999AC52809D651C9CC5A5FDC71302C|skfA]→[gene|F31B12F80AFC3580FD33811A1C22E74F75DC1A85|skfH]

2022-12-07 05:23:35

ghost

50

f96cb932f6aa46632dc613334e3526e3904b2534

E1A5B1DE7F5A4653FA0FC2E7FE7AAD3454DBFF28

Biological materials
Mutant
MGNA-C514 (ybcS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2512 NBRP B. subtilis, Japan]
BKE01935 ([gene|4DFF9924E07D834F37580D73E88451C1671C5111|skfC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01935 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCAGAACACCAATGATAGAC,  downstream forward: _UP4_CTCTAATGATTAGGAGAAGA
BKK01935 ([gene|4DFF9924E07D834F37580D73E88451C1671C5111|skfC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01935 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCAGAACACCAATGATAGAC,  downstream forward: _UP4_CTCTAATGATTAGGAGAAGA
References
Reviews
20955377
Original Publications
12817086,15812018,16816204,14651647,15687200,15687200,17720793,17449691,18840696,27766092

4DFF9924E07D834F37580D73E88451C1671C5111

Page visits: 1767

Time of last update: 2022-12-09 03:34:43

Author of last update: Bzhu