gabT

gabT
168

gamma-aminobutyrate transaminase, general stress protein

locus
BSU_03900
Molecular weight
47.09 kDa
pI
5.3
Protein length
Gene length
function
utilization of gamma-amino butyric acid
product
gamma-aminobutyrate transaminase
essential
no
ec
2.6.1.19
synonyms
gabT, ycnG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0160

This gene is a member of the following regulons

Gene
Coordinates
441,571 → 442,881
Phenotypes of a mutant
growth defect in the presence of gamma-aminobutyrate  [Pubmed|24127574]
no growth with gamma-aminobutyrate as single carbon source  [Pubmed|24529384]
The protein
Catalyzed reaction/ biological activity
4-aminobutanoate + 2-oxoglutarate --> succinate semialdehyde + L-glutamate (according to UniProt)
(S)-3-amino-2-methylpropanoate + 2-oxoglutarate --> 2-methyl-3-oxopropanoate + L-glutamate (according to UniProt)
the protein was reported to be involved in norspermidine production and biofilm disassembly [Pubmed|22541437]; however, this is not the case [Pubmed|24529384]and the original paper has been [http://www.cell.com/cell/fulltext/S0092-8674(15)00495-X retracted]
Protein family
[wiki|Class-III pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
[wiki|Cofactors]
PLP (according to UniProt)
Structure
[PDB|1SF2] (from E. coli, 45% identity) [pubmed|15323550]
[AF|P94427]
Paralogous protein(s)
[protein|E5F6DF14A4C01B2C90F70E37908D3697BC1B5FEF|yhxA], (32.8%)
Expression and Regulation
Operons
genes
[gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]-[gene|A0BEB92D54799956A4ADE106A1388E5710141069|gabD]
description
[Pubmed|12123465]
regulation
''[protein|search|gabD]'': induced by stress ([protein|search|SigB]) [Pubmed|15805528]
regulatory mechanism
[protein|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR]: activation, [Pubmed|32147931,12123465], in [regulon|protein:C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12123465], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]→[gene|A0BEB92D54799956A4ADE106A1388E5710141069|gabD]

2022-11-24 21:46:38

ghost

29

e3e4e1f1822033b4069ae3a9c7bc374af762e4a0

3807B263B7F7E1F259288EF64815902EECED7726

Biological materials
Mutant
MGNA-C068 (ycnG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2066 NBRP B. subtilis, Japan]
BKE03900 (Δ[gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGAATATCCCCCTGTC,  downstream forward: _UP4_TAATCATTGGAAAGAAAATG
BKK03900 (Δ[gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGAATATCCCCCTGTC,  downstream forward: _UP4_TAATCATTGGAAAGAAAATG
labs
[wiki|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
References
15223311,12123465,22541437,24529384,4590473,26681693,15323550,32147931

4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B

Page visits: 2848

Time of last update: 2022-12-06 04:27:14

Author of last update: Jstuelk