yckE

yckE
168

aryl--glucosidase

locus
BSU_03410
Molecular weight
54.97 kDa
pI
5.57
Protein length
Gene length
function
utilization of aryl--glucosides
product
aryl--glucosidase
essential
no
ec
3.2.1.86
synonyms
yckE, bglC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2723

This gene is a member of the following regulons

Gene
Coordinates
370,259  371,692
The protein
Catalyzed reaction/ biological activity
6-phospho-β-D-glucosyl-(1→4)-D-glucose + H2O --> D-glucose + D-glucose 6-phosphate (according to UniProt)
Protein family
[wiki|glycosyl hydrolase 1 family] (according to UniProt)
Structure
[PDB|4ZE4] (from Geobacillus stearothermophilus, 72% identity)
[AF|P42403]
Expression and Regulation
Operons
genes
[gene|4E626CEED2AB27442B49C199CAFDA89333D44715|yckE]
description
[pubmed|22383849]
Open in new tab

[gene|4E626CEED2AB27442B49C199CAFDA89333D44715|yckE]

2022-11-29 03:34:10

Jstuelk

16

076c9ef74d3cbd65d123898714d9182bbc9a82ab

0E453302443666C39AE927CC4DD465A289F5EC5E

Biological materials
Mutant
MGNA-C055 (yckE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2053 NBRP B. subtilis, Japan]
BKE03410 ([gene|4E626CEED2AB27442B49C199CAFDA89333D44715|yckE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGTGTTTATCACTCCTG,  downstream forward: _UP4_TAAAGAGTCCCTGAGAGTTA
BKK03410 ([gene|4E626CEED2AB27442B49C199CAFDA89333D44715|yckE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGTGTTTATCACTCCTG,  downstream forward: _UP4_TAAAGAGTCCCTGAGAGTTA
References
14652714,15139916,18069788

4E626CEED2AB27442B49C199CAFDA89333D44715

Page visits: 1111

Time of last update: 2022-11-30 23:45:55

Author of last update: Melvin.boenninger