glnL

glnL
168

two-component response regulator, regulation of the glsA-glnT operon

locus
BSU_02450
Molecular weight
35.56 kDa
pI
7.02
Protein length
Gene length
function
regulation of the glsA-glnT operon
product
two-component response regulator
essential
no
ec
null
synonyms
glnL, ycbB, yzgB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2197

This gene is a member of the following regulons

Gene
Coordinates
266,719  267,663
The protein
[wiki|Domains]
[wiki|Response regulatory domain] (aa 2–118) (according to UniProt)
Structure
[AF|P40759]
Modification
phosphorylated by [protein|C18B886D06879C64B64606371E85A7D4D22DCFAC|glnK] on an Asp residue
Effectors of protein activity
phosphorylation likely affects DNA-binding activity
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|C18B886D06879C64B64606371E85A7D4D22DCFAC|glnK]-[gene|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|glnL]
description
[pubmed|22383849]
Open in new tab

[gene|C18B886D06879C64B64606371E85A7D4D22DCFAC|glnK]→[gene|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|glnL]

2022-12-01 07:55:06

Jstuelk

27

53ffb3f99cce8c4721a7de587eae3ce84afee383

5FB071BA0D146528DE35BFF31F938BD208BF8C20

Biological materials
Mutant
MGNA-C026 (ycbB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2024 NBRP B. subtilis, Japan]
BKE02450 ([gene|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|glnL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTTTGGTTCACCCT,  downstream forward: _UP4_TAAACCAAACAGCCGGCTGA
BKK02450 ([gene|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|glnL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTTTGGTTCACCCT,  downstream forward: _UP4_TAAACCAAACAGCCGGCTGA
References
10094672,15995196

4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B

Page visits: 1698

Time of last update: 2022-11-30 14:16:19

Author of last update: Melvin.boenninger