rsiW

rsiW
168

anti-[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]

locus
BSU_01740
Molecular weight
23.19 kDa
pI
6.65
Protein length
Gene length
function
control of [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW] activity
product
anti-[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]
essential
no
synonyms
rsiW, ybbM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5662

This gene is a member of the following regulons

Gene
Coordinates
195,426  196,052
The protein
Protein family
zinc-associated anti-sigma factor (ZAS) superfamily (with [protein|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD], according to UniProt)
anti-sigma-W factor family (single member, according to UniProt)
[wiki|Domains]
The cytoplasmic domain is able to inactivate SigW and the extracellular and transmembrane domains are crucial for sensing and transducing the signal that triggers SigW activation (PubMed:15130127). The N-terminus binds the zinc ion and is followed by a long helix (about residues 40-80) that fits into a hydrophobic surface groove on SigW, probably blocking its ability to interact with the -10 and -35 promoter elements (PubMed:28319136).
Structure
[PDB|5WUQ] (the cytoplasmic domain in complex with [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]) [pubmed|28319136]
[AF|Q45588]
Effectors of protein activity
degraded by [protein|CB50289535EA537F63BADD459BD11AA7759A6658|rasP] and [protein|EE3B6B52EA19958E2E46A1545747F5209A6AA036|prsW] under conditions of alkali shock or in the presence of antimicrobial peptides, respectively. This results in the release of [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]-[gene|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]
description
[Pubmed|12207695]
regulation
induced under conditions of alkali shock or in the presence of the toxin [protein|search|SdpC] ([protein|search|SigW]) [Pubmed|12207695]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|12076816], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|12207695], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
additional information
the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]→[gene|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]

2022-12-01 05:36:41

ghost

39

f173494f184da3acb9643a06d22253706f42bb28

A73BFA90A2F503CCE374A383B36C83668CF7F3DD

Biological materials
Mutant
MGNA-B953 (ybbM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1952 NBRP B. subtilis, Japan]
BKE01740 ([gene|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGGACAGCTCATTTCATCAC,  downstream forward: _UP4_TAAAGCGCGTTAGCCGCTTT
BKK01740 ([gene|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|rsiW]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGGACAGCTCATTTCATCAC,  downstream forward: _UP4_TAAAGCGCGTTAGCCGCTTT
labs
[wiki|Thomas Wiegert], University of Bayreuth, Germany [http://www.genetik.uni-bayreuth.de/LSGenetik1/Thomas%20Wiegert-Dateien/Thomas%20Wiegert.html Homepage]
References
Reviews
20836086,22381678,29343670
Original Publications
17020587,14993308,16816000,18599827,12207695,16899079,15130127,12884008,12076816,19889088,14993308,28319136,28674070

4E720917045032E8B45CB8AF6E5C13AE0E48EE33

Page visits: 2831

Time of last update: 2022-12-05 22:06:41

Author of last update: Melvin.boenninger