ydbA

ydbA
168

unknown

locus
BSU_04390
Molecular weight
31.09 kDa
pI
9.22
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydbA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
493,559  494,377
The protein
Structure
[AF|P96596]
Expression and Regulation
Operons
genes
[gene|4F706E2F908A8FD638FFA3D8E8810539E5A5FC09|ydbA]
description
[Pubmed|22383849]
Open in new tab

[gene|4F706E2F908A8FD638FFA3D8E8810539E5A5FC09|ydbA]

2022-11-18 11:51:00

Jstuelk

9

37fdfdff293f55d9402090c7f3083e89ecabe39a

531EE4D2DFA2723084A843F8F006AC4776C0DD59

Biological materials
Mutant
MGNA-C092 (ydbA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2090 NBRP B. subtilis, Japan]
BKE04390 ([gene|4F706E2F908A8FD638FFA3D8E8810539E5A5FC09|ydbA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04390 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCCAACCCGCACTTCCCT,  downstream forward: _UP4_TAGCAGAAAGCAGACGGACA
BKK04390 ([gene|4F706E2F908A8FD638FFA3D8E8810539E5A5FC09|ydbA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04390 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCCAACCCGCACTTCCCT,  downstream forward: _UP4_TAGCAGAAAGCAGACGGACA

4F706E2F908A8FD638FFA3D8E8810539E5A5FC09

Page visits: 1054

Time of last update: 2022-11-26 19:28:37

Author of last update: Jstuelk