phrH

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

phrH
168

secreted regulator of the activity of phosphatase [protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH]

locus
BSU_06839
Molecular weight
6.30 kDa
pI
9.518
Protein length
Gene length
function
control of [wiki|sporulation] initiation
product
secreted regulator of the activity of phosphatase [protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH]
essential
no
synonyms
phrH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
752,079  752,252
The protein
Protein family
[wiki|phr family] (according to UniProt)
Structure
[AF|Q59HN7]
[wiki|Localization]
secreted as hexapeptide TDRNTT [Pubmed|21908671], uptake by the ([protein|05752B9C4EA7ACD579D65D028B7DF1861F3840CB|oppD]-[protein|38AD697B6C9967B8BD7496E31264A21F6D0A9DEE|oppF])-([protein|B0A3C7B253FB1DA1D4BC9D1D564905ECE8A65BC1|oppB]-[protein|DDBCE73B6AF39E5D669475479186C93F287DA9FC|oppC])-[protein|302DFA46D73E18C4663468ED6033C55056744475|oppA] [wiki|ABC transporter] [Pubmed|21908671]
Expression and Regulation
Operons
genes
[gene|4FA7D6E6316A6FC71C10C692D125833263894020|phrH]
description
[Pubmed|21908671]
regulation
''[protein|search|rapH]'': repressed by [protein|search|RghR] [Pubmed|16553878]
regulatory mechanism
[protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|rghR]: repression, [Pubmed|16553878], in [regulon|protein:972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|rghR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|21908671], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|4FA7D6E6316A6FC71C10C692D125833263894020|phrH]

2022-05-17 23:47:18

ghost

9

ed71f8fcdf72624dcf2fd161da99b113147b0e5e

234649211BC49B7CF0AC95F4CFDC16783495188D

genes
[gene|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH]-[gene|4FA7D6E6316A6FC71C10C692D125833263894020|phrH]
description
[Pubmed|21908671]
regulation
''[protein|search|rapH]'': repressed by [protein|search|RghR] [Pubmed|16553878]
regulatory mechanism
[protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|rghR]: repression, [Pubmed|16553878], in [regulon|protein:972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|rghR regulon]
[protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]: activation, [Pubmed|11948146,11918817], in [regulon|protein:08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|21908671], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH]→[gene|4FA7D6E6316A6FC71C10C692D125833263894020|phrH]

2022-04-30 14:04:32

ghost

27

afdfd4e58aa462c1f34c8519b1214c943fc47156

3178B428D9699AC0C49193C0A58CC78CB3717A7F

Biological materials
Mutant
BKE06839 ([gene|4FA7D6E6316A6FC71C10C692D125833263894020|phrH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06839 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGCCAGACACATCATCACTT,  downstream forward: _UP4_TAGGGCTTTTTCTTGCTTTA
BKK06839 ([gene|4FA7D6E6316A6FC71C10C692D125833263894020|phrH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06839 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGCCAGACACATCATCACTT,  downstream forward: _UP4_TAGGGCTTTTTCTTGCTTTA
References
16553878

4FA7D6E6316A6FC71C10C692D125833263894020

Page visits: 1287

Time of last update: 2022-05-19 18:57:12

Author of last update: Melvin.boenninger