ytrE

ytrE
168

[wiki|ABC transporter] (ATP-binding protein)

locus
BSU_30420
Molecular weight
25.31 kDa
pI
5.98
Protein length
Gene length
function
unknown
product
[wiki|ABC transporter] (ATP-binding protein)
essential
no
synonyms
ytrE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1136

This gene is a member of the following regulons

Gene
Coordinates
3,115,279  3,115,974
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 4-231) (according to UniProt)
Structure
[PDB|1L2T] (from Methanocaldococcus jannaschii, 44% identity) [pubmed|12150914]
[AF|O34392]
Paralogous protein(s)
[protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|yxdL], [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE], [protein|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA], [protein|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY], [protein|0F8048267EC038D8CF673317D969BA27735473A7|yvrO]
[wiki|Localization]
cell membrane (via [protein|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[protein|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]) [Pubmed|10986249]
Expression and Regulation
Operons
genes
[gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]-[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]-[gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF]
description
[Pubmed|10986249,21856850]
regulation
expressed early in the stationary phase [Pubmed|10986249]
regulatory mechanism
[protein|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]: repression, [Pubmed|10986249,21856850], in [regulon|protein:6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10986249,21856850], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]→[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF]

2022-12-04 00:50:53

Jstuelk

39

511c9f88e4f29ce72433096dbf0fd3dc5c038eeb

AE29C5AEECDD6994F28E6275F3C275A0539AF619

Biological materials
Mutant
GP3191 (Δ[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]), available in [wiki|Jörg Stülke]'s lab [pubmed|33897624]
GP2646 Δ([gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]-[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]-[gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF])::''ermC'', available in [wiki|Jörg Stülke]'s lab [pubmed|33897624]
MGNA-B537 (ytrE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1536 NBRP B. subtilis, Japan]
BKE30420 ([gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE30420 BGSC] and in [wiki|Jörg Stülke]'s lab,  [Pubmed|28189581], upstream reverse: _UP1_ATCAATCATATGTTCTCTCT,  downstream forward: _UP4_GGTGTGCTAAAAGGAGGAAT
BKK30420 ([gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK30420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCAATCATATGTTCTCTCT,  downstream forward: _UP4_GGTGTGCTAAAAGGAGGAAT
References
10986249,10092453,12399512,22926563,12150914,33450852,33897624

4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB

Page visits: 2643

Time of last update: 2022-12-03 09:54:09

Author of last update: Jstuelk