ykkD

ykkD
168

putative guanidine exporter

locus
BSU_13100
Molecular weight
11.19 kDa
pI
8.62
Protein length
Gene length
function
export/ detoxification of guanidine
product
subunit of guanidine exporter
essential
no
synonyms
ykkD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2076

This gene is a member of the following regulons

Gene
Coordinates
1,376,855  1,377,172
The protein
Protein family
paired small multidrug resistance  protein family ([wiki|PSMR family]) [Pubmed|17942072]
[wiki|drug/metabolite transporter (DMT) superfamily] (according to UniProt)
[wiki|Small multidrug resistance (SMR) (TC 2.A.7.1) family] (according to UniProt)
Structure
[PDB|3B5D] (from E. coli, 29% identity) [pubmed|18024586]
[AF|P49857]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|5FD89F65E481CDC33B10A58C12C3168B929917ED|ykkC]-[gene|5001019AD87FEF7D7A920D570C1053D476F7F20C|ykkD]
description
[Pubmed|10735877]
regulation
induced in the presence of guanidine ([wiki|ykkC riboswitch]) [Pubmed|27989440]
regulatory mechanism
[protein|E9866855F0156859C45E98F3B385FE1263BB7EBC|YkkC riboswitch]: antitermination, [pubmed|28060483,27989440], in [regulon|protein:E9866855F0156859C45E98F3B385FE1263BB7EBC|YkkC riboswitch regulon]
Open in new tab

[gene|5FD89F65E481CDC33B10A58C12C3168B929917ED|ykkC]→[gene|5001019AD87FEF7D7A920D570C1053D476F7F20C|ykkD]

2022-11-21 14:42:33

ghost

15

12ef4a40f3191d055e1518a030274c88ec540d1a

CFA7D4F021B5D5A483940692B621927D162FE138

Biological materials
Mutant
MGNA-A748 (ykkD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/748 NBRP B. subtilis, Japan]
BKE13100 ([gene|5001019AD87FEF7D7A920D570C1053D476F7F20C|ykkD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATAAACTGATCCAGTGCA,  downstream forward: _UP4_TAAATTGATTTTTATCAAAT
BKK13100 ([gene|5001019AD87FEF7D7A920D570C1053D476F7F20C|ykkD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATAAACTGATCCAGTGCA,  downstream forward: _UP4_TAAATTGATTTTTATCAAAT
References
Reviews
17942072
Original Publications
10735877,21317561,27989440,27120414,18024586

5001019AD87FEF7D7A920D570C1053D476F7F20C

Page visits: 1089

Time of last update: 2022-12-07 06:15:01

Author of last update: Melvin.boenninger