SubtiWiki SubtiWiki
serB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

serB
168

phosphoserine phosphatase, catalyzes the last step in serine biosynthesis

locus
BSU_28940
Molecular weight
29.36 kDa
pI
4.67
Protein length
Gene length
function
biosynthesis of serine
product
phosphoserine phoshatase
essential
no
synonyms
serB, ysaA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1011

This gene is a member of the following regulons

Gene
Coordinates
2,958,434  2,959,216
Phenotypes of a mutant
auxotrophic for serine [Pubmed|28189581]
The protein
Catalyzed reaction/ biological activity
phosphoserine - serine + phosphate [Pubmed|28189581]
Protein family
[wiki|HAD superfamily] (according to UniProt)
Structure
[PDB|2GFH] (from mouse, 32% identity)
Paralogous protein(s)
[protein|2E1E22349750C3EE9B6575EED30A82ED0D5F07F0|yfnB]
Expression and Regulation
Operons
genes
[gene|50417B2FA0ED2258A13B1E708514F055297599EF|serB]
description
[pubmed|22383849,8969504]
Open in new tab

[gene|50417B2FA0ED2258A13B1E708514F055297599EF|serB]

2022-01-24 14:10:31

Bzhu

8

c260c30e2d0aad79604f6ffd46f286ba24b06f75

B809801270CD0848F959480D8B05447FE47894E4

Biological materials
Mutant
MGNA-A998 [gene|50417B2FA0ED2258A13B1E708514F055297599EF|serB]::erm, available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/998 NBRP B. subtilis, Japan]
BKE28940 ([gene|50417B2FA0ED2258A13B1E708514F055297599EF|serB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCTCCTCTGCTT,  downstream forward: _UP4_TAAAAAAAGCATGATCTCTT
BKK28940 ([gene|50417B2FA0ED2258A13B1E708514F055297599EF|serB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCTCCTCTGCTT,  downstream forward: _UP4_TAAAAAAAGCATGATCTCTT
References
8969504,27784292,28189581

50417B2FA0ED2258A13B1E708514F055297599EF

Page visits: 1228

Time of last update: 2022-01-26 23:01:24

Author of last update: Melvin.boenninger