SubtiWiki SubtiWiki
ybfH

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ybfH
168

unknown

locus
BSU_02210
Molecular weight
33.69 kDa
pI
8.36
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ybfH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0697

This gene is a member of the following regulons

Gene
Coordinates
241,917  242,837
The protein
Protein family
[wiki|eamA transporter family] (according to UniProt)
[wiki|Domains]
2[wiki|EamA domain]s (aa 18-141, aa 162-291) (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|0AD208CFDA10F7BED022583C8448EFA7E37B9E33|ybfI]-[gene|5084B6223B9F261E9FE1C65CD3F5FE20AF7E5ECE|ybfH]
description
[Pubmed|22383849]
Open in new tab

[gene|0AD208CFDA10F7BED022583C8448EFA7E37B9E33|ybfI]→[gene|5084B6223B9F261E9FE1C65CD3F5FE20AF7E5ECE|ybfH]

2021-12-30 17:07:32

Jstuelk

3

96930bc6f3d45b8344be09939d97830108847977

F7F7581C5C602A2B1305A943D91F26A17C07592B

Biological materials
Mutant
MGNA-B969 (ybfH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1968 NBRP B. subtilis, Japan]
BKE02210 ([gene|5084B6223B9F261E9FE1C65CD3F5FE20AF7E5ECE|ybfH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCCCGAAGTTTCTCTTTGTA,  downstream forward: _UP4_TAACGGCATCCATTTTTTTA
BKK02210 ([gene|5084B6223B9F261E9FE1C65CD3F5FE20AF7E5ECE|ybfH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CCCCGAAGTTTCTCTTTGTA,  downstream forward: _UP4_TAACGGCATCCATTTTTTTA

5084B6223B9F261E9FE1C65CD3F5FE20AF7E5ECE

Page visits: 1056

Time of last update: 2022-01-18 10:34:04

Author of last update: Melvin.boenninger