yhdY

yhdY
168

mechanosensitive channel, similar to MscS

locus
BSU_09640
Molecular weight
42.38 kDa
pI
5.76
Protein length
Gene length
function
resistance to osmotic downshock
product
mechanosensitive channel, similar to MscS
essential
no
synonyms
yhdY

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0668

This gene is a member of the following regulons

Gene
Coordinates
1,038,909  1,040,024
The protein
Protein family
[wiki|MscS (TC 1.A.23) family] (according to UniProt)
Structure
[PDB|4AGE] (MscS from E. coli, corresponds to aa 129 ... 358 of YhdY, 27% identity) [pubmed|23012406]
[AF|O07594]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|50DC162B3A7798F8D10B8373968AD333F197360B|yhdY]
description
[Pubmed|21815947]
Open in new tab

[gene|50DC162B3A7798F8D10B8373968AD333F197360B|yhdY]

2022-11-19 08:45:07

Jstuelk

12

c9eb5254864250857210d13055f05771a7bbf1b4

9C6592FDB7105CC739ED109D40ECB38451B6971A

additional information
the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
Biological materials
Mutant
MGNA-A701 (yhdY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/701 NBRP B. subtilis, Japan]
1A958 ( ''yhdY''::''erm''), [Pubmed|18310427], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A958&Search=1A958 BGSC]
1A958 ( ''yhdY''::''erm''), [Pubmed|18310427], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A958&Search=1A958 BGSC]
BKE09640 ([gene|50DC162B3A7798F8D10B8373968AD333F197360B|yhdY]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACTGTCTCCCCTCTAT,  downstream forward: _UP4_TAAAAGAGAGACTTCGTCTG
BKK09640 ([gene|50DC162B3A7798F8D10B8373968AD333F197360B|yhdY]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACTGTCTCCCCTCTAT,  downstream forward: _UP4_TAAAAGAGAGACTTCGTCTG
References
Reviews
12626684,22685280,22404681,24607989,17505523,33244613
Original Publications
17665170,18310427,19252899,21815947,26883633,23012406,33568813
Labs working on this gene/protein
[wiki|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]

50DC162B3A7798F8D10B8373968AD333F197360B

Page visits: 1123

Time of last update: 2022-11-26 15:43:48

Author of last update: Jstuelk