thiC

thiC
168

4-amino-5-hydroxymethyl-2-methylpyrimidine phosphate (HMP-P) synthase, biosynthesis of the pyrimidine moiety of thiamine

locus
BSU_08790
Molecular weight
65.74 kDa
pI
5.26
Protein length
Gene length
function
biosynthesis of thiamine
product
4-amino-5-hydroxymethyl-2-methylpyrimidine phosphate (HMP-P) synthase
essential
no
synonyms
thiC, thiA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0422

This gene is a member of the following regulons

Gene
Coordinates
955,895  957,667
The protein
Catalyzed reaction/ biological activity
5-amino-1-(5-phospho-β-D-ribosyl)imidazole + S-adenosyl-L-methionine --> 4-amino-2-methyl-5-(phosphooxymethyl)pyrimidine + 5'-deoxyadenosine + CO + formate + 3 H+ + L-methionine (according to UniProt)
Protein family
thiC family (single member, according to UniProt)
[wiki|Cofactors]
Fe-S cluster [pubmed|29292548]
Structure
[PDB|3EPN] (from Caulobacter crescentus, 65% identity) [pubmed|18953358]
[AF|P45740]
Modification
phosphorylated on Arg-556 [Pubmed|22517742]
phosphorylated on Ser-565, Ser-586 and Tyr-589 [Pubmed|20509597]
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
Expression and Regulation
Operons
genes
[gene|51B5F268EE71DD28741A38F72E507B6E245D5494|thiC]
description
[Pubmed|22383849]
regulation
repressed by thiamine ([wiki|Thi-box]) [Pubmed|12376536]
the [wiki|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [wiki|RNA switch], in [regulon|protein:E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
Open in new tab

[gene|51B5F268EE71DD28741A38F72E507B6E245D5494|thiC]

2022-11-23 02:57:28

Jstuelk

20

912da64c2149c634effa834239fc89e9aaa6bc4a

848AEFB0DD859F65873E9FA627981725B72E955A

Biological materials
Mutant
1A603 ( ''thiC''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A603&Search=1A603 BGSC]
BKE08790 ([gene|51B5F268EE71DD28741A38F72E507B6E245D5494|thiC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTTCCTTCCCCTT,  downstream forward: _UP4_TAAAAAAAATGAAGATGGAG
BKK08790 ([gene|51B5F268EE71DD28741A38F72E507B6E245D5494|thiC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACTTTTCCTTCCCCTT,  downstream forward: _UP4_TAAAAAAAATGAAGATGGAG
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
References
Reviews
19348578,10382260
Original Publications
16291685,9370266,20509597,12376536,22517742,22383849,18953358,28516784,29794222

51B5F268EE71DD28741A38F72E507B6E245D5494

Page visits: 5376

Time of last update: 2022-11-28 12:04:43

Author of last update: Melvin.boenninger