SubtiWiki SubtiWiki
ywfM

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ywfM
168

unknown

locus
BSU_37630
Molecular weight
31.19 kDa
pI
9.77
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ywfM, ipa-91d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5006

This gene is a member of the following regulons

Gene
Coordinates
3,862,357  3,863,247
The protein
Protein family
[wiki|EamA transporter family] (according to UniProt)
[wiki|Domains]
2 [wiki|EamA domain]s (aa 15-138, aa 158-282) (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|522E49C265286CBC191334F4EFD864D81D59E3CB|ywfM]
description
[Pubmed|22383849]
Open in new tab

[gene|522E49C265286CBC191334F4EFD864D81D59E3CB|ywfM]

2021-10-19 08:50:55

Jstuelk

2

a7dd6f9df79d1f3d829455667c5f24224b681aa9

F6857E64B7EFEDBC89663EA846ABBD666CAEB88B

Biological materials
Mutant
MGNA-A582 (ywfM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/582 NBRP B. subtilis, Japan]
BKE37630 ([gene|522E49C265286CBC191334F4EFD864D81D59E3CB|ywfM]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGCCTCTCCCCTTTAA,  downstream forward: _UP4_TAATAGATTCACATAAGCTT
BKK37630 ([gene|522E49C265286CBC191334F4EFD864D81D59E3CB|ywfM]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGCCTCTCCCCTTTAA,  downstream forward: _UP4_TAATAGATTCACATAAGCTT
References
20525796

522E49C265286CBC191334F4EFD864D81D59E3CB

Page visits: 786

Time of last update: 2022-01-15 10:44:30

Author of last update: Melvin.boenninger