yclK

yclK
168

two-component sensor kinase

locus
BSU_03760
Molecular weight
54.88 kDa
pI
6.15
Protein length
Gene length
function
unknown
product
two-component sensor kinase
essential
no
ec
null
synonyms
yclK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0642

This gene is a member of the following regulons

Gene
Coordinates
427,247  428,668
The protein
Catalyzed reaction/ biological activity
autophosphorylation, phosphorylation of [protein|706983E6942E883D3A9D45693E7B4015AEABE60B|yclJ]
ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
[wiki|Domains]
two transmembrane segments
[wiki|HAMP domain] (aa 187-239) (according to UniProt)
[wiki|Histidine kinase domain] (aa 254-470) (according to UniProt)
Structure
[PDB|4I5S] (from Streptococcus mutans, corresponds to the [wiki|Histidine kinase domain], aa 240 ... 467, 33% identity) [pubmed|23468592]
[AF|P94414]
Modification
autophosphorylation on a His residue
Paralogous protein(s)
[protein|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|yvrG], [protein|9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B|ykoH], [protein|1582E81F7DA85F38D6732D341ABD0F052587F25A|kinE], [protein|4EE48E4931F662E51586DB6D01E91C688329222D|cssS]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|706983E6942E883D3A9D45693E7B4015AEABE60B|yclJ]-[gene|52BB660B0CAB36C74F1D47963235846B45AF78AB|yclK]
description
[Pubmed|15375128]
regulation
expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|15375128]
regulatory mechanism
[protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]: activation, [Pubmed|15375128], in [regulon|protein:1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD regulon]
Open in new tab

[gene|706983E6942E883D3A9D45693E7B4015AEABE60B|yclJ]→[gene|52BB660B0CAB36C74F1D47963235846B45AF78AB|yclK]

2022-11-30 13:13:59

ghost

29

c8ce174a850d100d730c47471cd54e3718b10202

35D763A96FACAEA24FD2F2D86E1687EA9C120E8E

Biological materials
Mutant
MGNA-C008 (yclK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2006 NBRP B. subtilis, Japan]
BKE03760 ([gene|52BB660B0CAB36C74F1D47963235846B45AF78AB|yclK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCTTAGCAGCAGCTGATATA,  downstream forward: _UP4_TAGCATACAGGGCGGCGCAT
BKK03760 ([gene|52BB660B0CAB36C74F1D47963235846B45AF78AB|yclK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GCTTAGCAGCAGCTGATATA,  downstream forward: _UP4_TAGCATACAGGGCGGCGCAT
References
10094672,15375128,23468592

52BB660B0CAB36C74F1D47963235846B45AF78AB

Page visits: 1366

Time of last update: 2022-12-01 07:54:22

Author of last update: Jstuelk