SubtiWiki SubtiWiki
glgB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

glgB
168

1,4-alpha-glucan branching enzyme

locus
BSU_30980
Molecular weight
73.49 kDa
pI
6.24
Protein length
Gene length
function
glycogen biosynthesis
product
1,4-alpha-glucan branching enzyme
essential
no
ec
2.4.1.18
synonyms
glgB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0296

This gene is a member of the following regulons

Gene
Coordinates
3,169,763  3,171,646
The protein
Catalyzed reaction/ biological activity
Transfers a segment of a (1->4)-alpha-D-glucan chain to a primary hydroxy group in a similar glucan chain (according to UniProt)
Protein family
[wiki|glycosyl hydrolase 13 family] (according to UniProt)
Structure
[PDB|5GQU] (from Cyanothece sp., 46% identity) [pubmed|28193843]
Paralogous protein(s)
[protein|7D783DD180D950A4B030BF5EA78CCE930A466A07|amyX]
Expression and Regulation
Operons
genes
[gene|52C8DE3C78B680C8883D1CD559CBC2D9ABFCC400|glgB]-[gene|B665735B76462724A3C7A1E89D3E613C18F21399|glgC]-[gene|63A4FD35A2E72C665BFA3F2632F06C7A0C954087|glgD]-[gene|EBEA85AD543B79C321CB5F28D1B7E1248640DC1D|glgA]-[gene|3AB4513126EFF54996A54CB7DEB6062C1A06AAC3|glgP]
description
[Pubmed|8145641]
regulation
expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|8145641]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|8145641], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|52C8DE3C78B680C8883D1CD559CBC2D9ABFCC400|glgB]→[gene|3AB4513126EFF54996A54CB7DEB6062C1A06AAC3|glgP]

2021-12-02 09:55:51

ghost

6

fffeb17cb5b6051e783d59196d95d7090a27b1c0

1789CF3539E2172289FC51E8FA1F9C213683180D

Biological materials
Mutant
BKE30980 ([gene|52C8DE3C78B680C8883D1CD559CBC2D9ABFCC400|glgB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAATCATCCTTTCTGA,  downstream forward: _UP4_AAAAAAAGAGGAGAGATAAA
BKK30980 ([gene|52C8DE3C78B680C8883D1CD559CBC2D9ABFCC400|glgB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAATCATCCTTTCTGA,  downstream forward: _UP4_AAAAAAAGAGGAGAGATAAA
References
8145641,28193843

52C8DE3C78B680C8883D1CD559CBC2D9ABFCC400

Page visits: 1225

Time of last update: 2022-01-19 05:42:10

Author of last update: Melvin.boenninger