yabN

yabN
168

similar to nucleoside triphosphate pyrophosphohydrolase

locus
BSU_00580
Molecular weight
55.94 kDa
pI
4.51
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yabN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3956

This gene is a member of the following regulons

Gene
Coordinates
66,405  67,874
The protein
[wiki|Domains]
contains a domain similar to  ''E. coli'' [http://ecocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG10572 ''mazG''] (nucleoside pyrophosphohydrolase) at the C-terminus (aa 240-480)
Structure
[PDB|3CRA] (E. coli MazG, corresponds to the C-terminal domain, aa 238 ... 486), 43.6% identity [pubmed|18353782]
[AF|P37556]
Expression and Regulation
Operons
genes
[gene|D6B1837075ECBEE1FEAC704DDB6795336092897F|yabM]-[gene|52D48F22CB53421EE30970D34B4861E2F8A5893D|yabN]-[gene|B0CB19A3E3E84E12BF42BB050394C8A059A89359|rqcP]-[gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]-[gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]-[gene|FE0E60B875E72AEF5174A89C7AE5556FF59B19D5|divIC]-[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]
description
[Pubmed|11283287]
regulation
expressed during sporulation ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]) [Pubmed|11283287]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,11283287], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|12207695], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|26577401], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|12207695], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|D6B1837075ECBEE1FEAC704DDB6795336092897F|yabM]→[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]

2022-11-22 17:48:11

Jstuelk

49

93952be38722510f984794e138450cd80a9f7d48

0CF3909333400A3BFE18E32016883124FFC3D75B

Biological materials
Mutant
MGNA-B915 (yabN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1914 NBRP B. subtilis, Japan]
BKE00580 ([gene|52D48F22CB53421EE30970D34B4861E2F8A5893D|yabN]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GGCACCAAGTCCGACGACTG,  downstream forward: _UP4_GAAACTGAGAGGAGATCATA
BKK00580 ([gene|52D48F22CB53421EE30970D34B4861E2F8A5893D|yabN]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GGCACCAAGTCCGACGACTG,  downstream forward: _UP4_GAAACTGAGAGGAGATCATA
References
11283287,26577401,18353782

52D48F22CB53421EE30970D34B4861E2F8A5893D

Page visits: 1558

Time of last update: 2022-11-28 23:07:09

Author of last update: Jstuelk