lmrA

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

lmrA
168

transcriptional regulator ([wiki|TetR family]), control of [gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]-[gene|search|yxaH ]and [gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]-[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]

locus
BSU_02680
Molecular weight
20.52 kDa
pI
5.03
Protein length
Gene length
function
regulation of lincomycin resistance
product
transcriptional regulator
essential
no
synonyms
lmrA, lin-2, yccB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1309

This gene is a member of the following regulons

Gene
Coordinates
290,132  290,698
The protein
Protein family
[wiki|TetR family]
[wiki|Domains]
[wiki|HTH tetR-type domain] (aa 4-64) (according to UniProt)
Structure
[PDB|1SGM] ([protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR], 56% identity) [pubmed|16475182]
[AF|O34619]
Effectors of protein activity
flavonoids such as quercetin serve as inducers, binding results in release from DNA [Pubmed|17483215]
Paralogous protein(s)
[protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|qdoR]
Expression and Regulation
Operons
genes
[gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]-[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]
description
[Pubmed|15317768]
regulation
induced by flavonoids such as quercetin ([protein|search|LmrA])[Pubmed|17483215]
regulatory mechanism
[protein|52D560AA02F0849CB24460A496021560063B2E12|lmrA]: repression, [Pubmed|15317768], in [regulon|protein:52D560AA02F0849CB24460A496021560063B2E12|lmrA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12499232], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Open in new tab

[gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]→[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]

2022-04-30 14:43:51

ghost

25

be7795d98f26be96a984dc95802c21f2dcb1e545

FCA0758D41C878E1059BF369D1C30C97AACB6B0C

Biological materials
Mutant
BKE02680 ([gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACATTCCCACCTTACT,  downstream forward: _UP4_TAAAAAAAACGACATACTAC
BKK02680 ([gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACATTCCCACCTTACT,  downstream forward: _UP4_TAAAAAAAACGACATACTAC
References
Reviews
24006471,25209494
Original Publications
15317768,17483215,12499232,21815947,16475182

52D560AA02F0849CB24460A496021560063B2E12

Page visits: 4342

Time of last update: 2022-05-19 17:56:42

Author of last update: Melvin.boenninger