yflB

yflB
168

stress protein

locus
BSU_07735
Molecular weight
15.00 kDa
pI
9
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yflB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
844,253  844,645
The protein
Structure
[AF|O34887]
Expression and Regulation
Operons
genes
[gene|EA62F1DF6BB9204BB7A6B0CC6A05F63D711A451F|yflD]-[gene|530844B354D43308CC8CB7DC30DB9731A5D698EB|yflB]-[gene|A69E7536DFE6353C4CD1B09D1258C88BF0FB8B4D|yflA]
description
[pubmed|22383849]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|26577401], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|EA62F1DF6BB9204BB7A6B0CC6A05F63D711A451F|yflD]->[gene|A69E7536DFE6353C4CD1B09D1258C88BF0FB8B4D|yflA]

2022-11-12 21:07:38

Bzhu

11

929952a921437e7e24d30bc95f1083941c360260

B659D971D9EF4AC4629A6558EDEA703E51FFF6A6

Biological materials
Mutant
MGNA-C342 (yflB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2340 NBRP B. subtilis, Japan]
BKE07735 ([gene|530844B354D43308CC8CB7DC30DB9731A5D698EB|yflB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07735 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCCATCATTTCACCTCTTT,  downstream forward: _UP4_TGATTTGTCTTGTCTGCAGG
BKK07735 ([gene|530844B354D43308CC8CB7DC30DB9731A5D698EB|yflB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07735 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCCATCATTTCACCTCTTT,  downstream forward: _UP4_TGATTTGTCTTGTCTGCAGG
References
20817675,26577401

530844B354D43308CC8CB7DC30DB9731A5D698EB

Page visits: 1093

Time of last update: 2022-11-26 11:03:04

Author of last update: Jstuelk