sacX

sacX
168

sucrose permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIIBC of the [category|SW.1.2.2|PTS], [category|SW.3.4.3|Trigger enzyme], control of [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY] activity

locus
BSU_38410
Molecular weight
48.86 kDa
pI
9.35
Protein length
Gene length
function
sucrose uptake and phosphorylation, control of [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY] activity
product
sucrose-specific [category|SW.1.2.2|PTS] permease, EIIBC component
essential
no
ec
2.7.1.69
synonyms
sacX, ipa-14r, sacS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1264

This gene is a member of the following regulons

Gene
Coordinates
3,942,234  3,943,613
The protein
Protein family
[category|SW.1.2.2|PTS] permease, sucrose family [Pubmed|10627040]
[wiki|Domains]
[wiki|PTS EIIB domain] type-1 (aa 1-86) (according to UniProt)
[wiki|PTS EIIC domain] type-1 (aa 106-459) (according to UniProt)
Structure
[AF|P15400]
Paralogous protein(s)
[protein|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP], [protein|BC568649A341B2E6341993EDA4BF52BDE18A3294|treP], [protein|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP], [protein|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|murP]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]-[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]
description
[Pubmed|2116367]
regulation
induction by sucrose (at high concentration) [Pubmed|8535520]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|1400159], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]: antitermination, in [regulon|protein:EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1400159], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]→[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]

2022-11-19 18:24:49

ghost

30

71b8be28ad46269e23e5788d9176f974f9403a5a

B12CDDD44C2FA327FE195497E0BB83EF99EBC6D4

Biological materials
Mutant
BKE38410 ([gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGCAATTAAAACCTCCTT,  downstream forward: _UP4_TAACTGGATTTATTCGATTT
BKK38410 ([gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGCAATTAAAACCTCCTT,  downstream forward: _UP4_TAACTGGATTTATTCGATTT
References
10627040,2105292,2116367,1400159,8535520,30038046

531F132F7F6A878F1E1D56977B9898A14272349A

Page visits: 6314

Time of last update: 2022-11-27 04:08:19

Author of last update: Melvin.boenninger