ispA

ispA
168

intracellular serine protease

locus
BSU_13190
Molecular weight
33.69 kDa
pI
4.52
Protein length
Gene length
function
protein degradation
product
intracellular serine protease
essential
no
synonyms
ispA, ispI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1404

This gene is a member of the following regulons

Gene
Coordinates
1,386,024  1,386,983
The protein
Protein family
[wiki|peptidase S8 family] (according to UniProt)
[wiki|Domains]
[wiki|Peptidase S8 domain] (aa 23-307) (according to UniProt)
Structure
[PDB|2WV7] (from Bacillus clausii, 53% identity) [pubmed|20541512]
[AF|P11018]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|53364B1E6728EA385E95F96E47AFDE6D65AD7040|ispA]
description
[Pubmed|22383849]
regulation
repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|23569278]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|23569278], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|3087947], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|53364B1E6728EA385E95F96E47AFDE6D65AD7040|ispA]

2022-12-29 12:48:29

Jstuelk

35

f2321c9c77fd866b54f57ee53cbf722b61055141

9B4A57BC278B7599EAF1A2490A607B8CF4237A4B

Biological materials
Mutant
BKE13190 ([gene|C75A4465688BCE9902F9CDC6DE069E36667377E1|yqiD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGCCCTCCTTTT,  downstream forward: _UP4_TAAGATTATTTTTCTTATAT
BKK13190 ([gene|C75A4465688BCE9902F9CDC6DE069E36667377E1|yqiD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGCCCTCCTTTT,  downstream forward: _UP4_TAAGATTATTTTTCTTATAT
References
Reviews
34410368
Original Publications
3087947,23569278,20541512

53364B1E6728EA385E95F96E47AFDE6D65AD7040

Page visits: 2175

Time of last update: 2023-02-01 11:26:23

Author of last update: Jstuelk