SubtiWiki SubtiWiki
gltT

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

gltT
168

major high-affinity Na+-coupled glutamate/ aspartate symport protein, uptake of glyphosate

locus
BSU_10220
Molecular weight
45.76 kDa
pI
9.03
Protein length
Gene length
function
glutamate and aspartate uptake
product
major Na+-coupled glutamate/ aspartate symport protein
essential
no
synonyms
gltT, yhfG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1301

This gene is a member of the following regulons

Gene
Coordinates
1,096,560  1,097,849
Phenotypes of a mutant
impaired uptake of glutamate and aspartate [Pubmed|25344233]
The protein
Catalyzed reaction/ biological activity
uptake of glutamate and aspartate
uptake of glyphosate and glufosinate [pubmed|30666812]
Protein family
[wiki|dicarboxylate/amino acid:cation symporter (DAACS) (TC 2.A.23) family] (according to UniProt)
Structure
[PDB|4IZM] (the protein from ''Pyrococcus horikoshii'', 35% identity, 73% similarity) [Pubmed|23563139]
[http://pdb.org/pdb/explore/explore.do?structureId=4KY0 4KY0] (the glutamate transporter of ''Thermococcus kodakarensis'', 35% identity, 72% similarity) [Pubmed|24013209]
Effectors of protein activity
aspartate uptake is competitively inhibited by glutamate [pubmed|29995990]
Kinetic information
Km values: 37 +/- 5 µM for glutamate, 41 +/- 9 µM for aspartate [pubmed|25344233]
KS for glutamate:
- 300 nM (at external KCl concentration of 0.1 mM) [pubmed|33481774]
- 60 nM (at external KCl concentration of 5 mM) [pubmed|33481774]
Paralogous protein(s)
[protein|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP], [protein|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|dctP]
[wiki|Localization]
cell membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]
description
[Pubmed|22383849]
Open in new tab

[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]

2021-11-03 07:51:13

ghost

4

64c078d13515d13574e741c958f0231553421806

5DFE10DA6C55ABFB33D5C95E7BC49557373AEEAB

Biological materials
Mutant
BP233 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''spc''), available in [wiki|Fabian Commichau]'s lab
GP2825 (Δ[gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]::''cat'' Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''kan''), available in [wiki|Jörg Stülke]'s lab
GP2247 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''ermC''), available in [wiki|Jörg Stülke]'s lab
GP2248 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''aphA3''), available in [wiki|Jörg Stülke]'s lab
GP2722 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''zeo''), available in [wiki|Jörg Stülke]'s lab
BKE10220 ([gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGATTACCTCCCAAAAA,  downstream forward: _UP4_TAATGAAAAGCCTGCGGGGT
BKK10220 ([gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGATTACCTCCCAAAAA,  downstream forward: _UP4_TAATGAAAAGCCTGCGGGGT
GP2831 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''aphA3'' Δ[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|aimA]::''phleo''), available in [wiki|Jörg Stülke]'s lab
Expression vectors
for expression in ''B. subtilis'', in [wiki|pAC7]: pBP56,  available in [wiki|Fabian Commichau]'s lab
FLAG-tag construct
GP3063 ''gltT-3xFLAG spc'' (based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
References
18763711,23563139,22383849,24013209,25344233,14596613,10588697,29995990,30666812,33481774

533EEB1A454D29800C9A00A0BE107ECEE2138DAB

Page visits: 3358

Time of last update: 2022-01-18 17:21:13

Author of last update: Jstuelk