ydbJ

ydbJ
168

similar to [wiki|ABC transporter] (ATP-binding protein)

locus
BSU_04490
Molecular weight
34.12 kDa
pI
4.73
Protein length
Gene length
function
unknown
product
[wiki|ABC transporter] (ATP-binding protein)
essential
no
synonyms
ydbJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1131

This gene is a member of the following regulons

Gene
Coordinates
502,908  503,834
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 6-234) (according to UniProt)
Structure
[PDB|4YER] (from Thermotoga maritima, 32% identity)
[AF|P96605]
Paralogous protein(s)
[protein|70858AED096A80C1EAEB81F4B048368B665AB515|yhcH]
[wiki|Localization]
membrane associated (via [protein|AE61E6752DF0F681C6DEBB8CD0970C7CDDA6F78E|ydbK]) [Pubmed|10092453]
Biological materials
Mutant
BKE04490 ([gene|5364730C4DD7FFFB238DA190889CECF6C63F1050|ydbJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAGCCTTCCTCCTTTT,  downstream forward: _UP4_GTCTAAATTAATTTGGAATG
BKK04490 ([gene|5364730C4DD7FFFB238DA190889CECF6C63F1050|ydbJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAGCCTTCCTCCTTTT,  downstream forward: _UP4_GTCTAAATTAATTTGGAATG
References
10092453,23033921,27120414

5364730C4DD7FFFB238DA190889CECF6C63F1050

Page visits: 1102

Time of last update: 2022-11-30 20:09:22

Author of last update: Melvin.boenninger