yhcM

yhcM
168

general stress protein

locus
BSU_09140
Molecular weight
16.89 kDa
pI
9.9
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yhcM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
988,417  988,872
The protein
Structure
[AF|P54597]
Expression and Regulation
Operons
genes
[gene|536B5EEE4EEAF2E3789B298B477C710F81C5DA2D|yhcM]
description
[Pubmed|12480901]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|12480901,15699190], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|536B5EEE4EEAF2E3789B298B477C710F81C5DA2D|yhcM]

2022-12-16 19:30:02

ghost

17

01968b0f0f4ce22fc3070688e944651366d84b3b

0F88989FAA3FD9E12B54213985B2D4161AC2BB95

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
MGNA-A670 (yhcM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/670 NBRP B. subtilis, Japan]
BKE09140 ([gene|536B5EEE4EEAF2E3789B298B477C710F81C5DA2D|yhcM]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCCCTCCTTTGCAGT,  downstream forward: _UP4_TAAAAAAACGTGTAATCCTC
BKK09140 ([gene|536B5EEE4EEAF2E3789B298B477C710F81C5DA2D|yhcM]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCCCTCCTTTGCAGT,  downstream forward: _UP4_TAAAAAAACGTGTAATCCTC
References
15805528,12480901,15699190,30782632

536B5EEE4EEAF2E3789B298B477C710F81C5DA2D

Page visits: 1844

Time of last update: 2023-02-05 02:46:19

Author of last update: Jstuelk