yhcF

yhcF
168

similar to transcriptional regulator ([wiki|GntR family])

locus
BSU_09060
Molecular weight
13.81 kDa
pI
5.46
Protein length
Gene length
function
unknown
product
transcriptional regulator ([wiki|GntR family])
essential
no
synonyms
yhcF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1725

This gene is a member of the following regulons

Gene
Coordinates
981,237  981,602
The protein
Protein family
[wiki|GntR family] of transcription factors
[wiki|Domains]
[wiki|HTH gntR-type domain] (aa 9-77) (according to UniProt)
Structure
[PDB|3NEU] (similar protein from ''Listeria innocua'', 38% identity)
[AF|P54590]
Expression and Regulation
Operons
genes
[gene|74B0D594308D313A54C7163759628655382B1F94|yhcE]-[gene|53E29A238EC817CE9B430BDED92DE8E9746C928B|yhcF]-[gene|E71E305A0DE5AB6BE24CE47DC1ECCD99670C24D8|yhcG]-[gene|70858AED096A80C1EAEB81F4B048368B665AB515|yhcH]-[gene|BAD93C5EAD25F1A257907F4C631C02FE97C7BC89|yhcI]
description
[pubmed|22383849]
Open in new tab

[gene|74B0D594308D313A54C7163759628655382B1F94|yhcE]→[gene|BAD93C5EAD25F1A257907F4C631C02FE97C7BC89|yhcI]

2022-11-27 05:30:45

Jstuelk

16

31fa6b1c8656f0d0bfc6538fd0cb31ed8b977260

CB2711BF696603B36EE5E8220D3ABF6009B00F6F

Biological materials
Mutant
MGNA-B473 (yhcF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1472 NBRP B. subtilis, Japan]
BKE09060 ([gene|53E29A238EC817CE9B430BDED92DE8E9746C928B|yhcF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GGATTGGAATTGATTGTCCA,  downstream forward: _UP4_AAAACATTCACAGAGGGAGG
BKK09060 ([gene|53E29A238EC817CE9B430BDED92DE8E9746C928B|yhcF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GGATTGGAATTGATTGTCCA,  downstream forward: _UP4_AAAACATTCACAGAGGGAGG
References
21815947,23504016

53E29A238EC817CE9B430BDED92DE8E9746C928B

Page visits: 1156

Time of last update: 2022-11-27 06:58:05

Author of last update: Melvin.boenninger