ywpD

ywpD
168

two-component orphan sensor kinase

locus
BSU_36350
Molecular weight
31.62 kDa
pI
6.96
Protein length
Gene length
function
unknown
product
two-component orphan sensor kinase
essential
no
ec
null
synonyms
ywpD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2972

This gene is a member of the following regulons

Gene
Coordinates
3,742,384  3,743,220
The protein
[wiki|Domains]
[wiki|Response regulatory domain] (aa 1-55) (according to UniProt)
Structure
[AF|P94586]
Expression and Regulation
Operons
genes
[gene|53EF65638E0001CA3679EA96A63C864F5F599B65|ywpD]
description
[Pubmed|22383849]
Open in new tab

[gene|53EF65638E0001CA3679EA96A63C864F5F599B65|ywpD]

2022-11-26 06:44:06

Jstuelk

13

0b159b79e0101971ced2c8b776364a5827effb10

D6B7079D4E93689D1C440DCDF416632671E4D1AF

Biological materials
Mutant
MGNA-A529 (ywpD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/529 NBRP B. subtilis, Japan]
BKE36350 ([gene|53EF65638E0001CA3679EA96A63C864F5F599B65|ywpD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE36350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACAGACTTCGAAACCAG,  downstream forward: _UP4_TAAACGAAAATTGAGATAAA
BKK36350 ([gene|53EF65638E0001CA3679EA96A63C864F5F599B65|ywpD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK36350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACAGACTTCGAAACCAG,  downstream forward: _UP4_TAAACGAAAATTGAGATAAA
References
10094672

53EF65638E0001CA3679EA96A63C864F5F599B65

Page visits: 983

Time of last update: 2022-11-26 17:58:29

Author of last update: Melvin.boenninger