spoVAA

spoVAA
168

essential for the uptake of the 1:1 chelate of pyridine-2,6-dicarboxylic acid (DPA(2,6)) and Ca(2 ) into developing spores, required for spore maturation

locus
BSU_23440
Molecular weight
23.03 kDa
pI
9.52
Protein length
Gene length
function
spore maturation
product
unknown
essential
no
synonyms
spoVAA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5834

This gene is a member of the following regulons

Gene
Coordinates
2,442,684  2,443,304
The protein
Structure
[AF|P40866]
[wiki|Localization]
inner spore membrane [Pubmed|26731423]
Expression and Regulation
Operons
genes
[gene|5410018998EC9792A69CF0D9C438EEF5AC8A82C5|spoVAA]-[gene|AEC70413BDC29F435776D532E7049AA9A0BD893D|spoVAB]-[gene|B280951A232E941FB0A6C8834049765BE1E16437|spoVAC]-[gene|9531F0A0DC4AE5696FFBAC9C2A773F15840E3255|spoVAD]-[gene|31D6CB7EC20C39C1815CA4552B8B9C4BE304E86B|spoVAEB]-[gene|B44529B69769D7AF1010E06C95E398EA91A3E798|spoVAEA]-[gene|CBE5093DFBBCE25071CCE12408BC9AFF7A158C03|spoVAF]-[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]
description
[Pubmed|7934830]
regulation
expressed late during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG], [wiki|SpoVT]) [Pubmed|15699190,1903432,8755877]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: activation, [Pubmed|8755877], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,1903432], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|5410018998EC9792A69CF0D9C438EEF5AC8A82C5|spoVAA]→[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]

2022-12-03 09:54:38

Jstuelk

27

12fce0add6fb0abbed0128cd99d7be2c377e96d5

420F73950DA10EFCB3126E84B350E66BA95D34DD

Biological materials
Mutant
BKE23440 ([gene|5410018998EC9792A69CF0D9C438EEF5AC8A82C5|spoVAA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE23440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATTGATCACCATCTTT,  downstream forward: _UP4_AATCAAGAAACCATAAAGGA
BKK23440 ([gene|5410018998EC9792A69CF0D9C438EEF5AC8A82C5|spoVAA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK23440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATTGATCACCATCTTT,  downstream forward: _UP4_AATCAAGAAACCATAAAGGA
labs
[wiki|Peter Setlow], University of Connecticut Health Center, USA
References
3114420,11751839,15451103,3926949,17158659,6432957,7934830,15699190,1903432,8755877,22328679,22343299,21398556,26731423

5410018998EC9792A69CF0D9C438EEF5AC8A82C5

Page visits: 1953

Time of last update: 2022-12-09 16:27:46

Author of last update: Jstuelk