proH

proH
168

pyrroline-5-carboxylate reductase

locus
BSU_18480
Molecular weight
31.88 kDa
pI
7.75
Protein length
Gene length
function
osmoadaptive de novo production of proline
product
pyrroline-5-carboxylate reductase
essential
no
ec
1.5.1.2
synonyms
proH, yoxE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0345

This gene is a member of the following regulons

Gene
Coordinates
2,016,845  2,017,738
The protein
Catalyzed reaction/ biological activity
1-pyrroline-5-carboxylate + NAD(P)H + H+ --> L-proline + NAD(P)+ [pubmed|28824574]
Protein family
[wiki|pyrroline-5-carboxylate reductase family] [pubmed|28824574]
[wiki|Cofactors]
NADPH [pubmed|28824574]
Structure
[PDB|5BSE] (from ''Medicago truncatula'', 36% identity) [pubmed|26579138]
[AF|P0CI77]
Effectors of protein activity
feedback-inhibited by proline [pubmed|28824574]
Paralogous protein(s)
[protein|93000B579F630E9F0C6EED40D6661E5E15141FDE|proI]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|542871C77BE841AA59A65FFE8A44AB85BF9180F0|proH]-[gene|3F47513FB71276EF1E99B8C427DC8DC0786F8C19|proJ]
description
[Pubmed|21296969]
regulation
expressed under conditions of osmotic stress [Pubmed|35593133,21784929]
induced upon antibiotic stress [pubmed|35593133]
expression
expression is heterogeneously activated [pubmed|35593133]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|21784929], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|542871C77BE841AA59A65FFE8A44AB85BF9180F0|proH]→[gene|3F47513FB71276EF1E99B8C427DC8DC0786F8C19|proJ]

2022-12-08 13:47:11

Jstuelk

36

7D11E4548AED5470042D4AD4B1A81BAF2078CCD0

AED34EA4995FE0B1F5AA7A879B3AA26AFD68CDB8

Biological materials
Mutant
HB24914 ([gene|542871C77BE841AA59A65FFE8A44AB85BF9180F0|proH]::''erm''), available in [wiki|John Helmann]'s and [wiki|Jörg Stülke]'s labs
MGNA-B083 (proH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1082 NBRP B. subtilis, Japan]
BKE18480 ([gene|542871C77BE841AA59A65FFE8A44AB85BF9180F0|proH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCACACGTTTAAAAT,  downstream forward: _UP4_GCGCCGCTATCAGGAGTGAT
BKK18480 ([gene|542871C77BE841AA59A65FFE8A44AB85BF9180F0|proH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCACACGTTTAAAAT,  downstream forward: _UP4_GCGCCGCTATCAGGAGTGAT
GP3709 ([gene|542871C77BE841AA59A65FFE8A44AB85BF9180F0|proH]::aphA3 trpC2) available in the [wiki|Stülke] lab
Expression vectors
pGP3800: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab
pGP3862: expression of Strep-''proH'' by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
References
Reviews
25367752
Original Publications
11418582,21296969,25344233,21784929,27766092,28752945,28824574,26579138,35593133

542871C77BE841AA59A65FFE8A44AB85BF9180F0

Page visits: 7639

Time of last update: 2022-12-07 20:20:57

Author of last update: Robert.warneke