yhcQ

yhcQ
168

unknown

locus
BSU_09180
Molecular weight
24.64 kDa
pI
5.74
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yhcQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5577

This gene is a member of the following regulons

Gene
Coordinates
990,612  991,265
The protein
Protein family
[wiki|CotF family] (according to UniProt)
Structure
[AF|P54601]
[wiki|Localization]
spore wall (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|5470621660C3AD6A3B82C4CEF5DAC3097EDC85B3|yhcQ]
description
(according to [http://dbtbs.hgc.jp/COG/prom/yhcQ.html DBTBS]) null
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|5470621660C3AD6A3B82C4CEF5DAC3097EDC85B3|yhcQ]

2022-12-17 05:35:42

ghost

16

a8d9bf174ecb4f256c9680db6315933a78999f67

378E888517BBEEA693967D7C3387AC4B6AAC2987

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
MGNA-A673 (yhcQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/673 NBRP B. subtilis, Japan]
BKE09180 ([gene|5470621660C3AD6A3B82C4CEF5DAC3097EDC85B3|yhcQ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACCGAATTCCTCCTTTT,  downstream forward: _UP4_CAGGATATGGAACAGCTGCG
BKK09180 ([gene|5470621660C3AD6A3B82C4CEF5DAC3097EDC85B3|yhcQ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACCGAATTCCTCCTTTT,  downstream forward: _UP4_CAGGATATGGAACAGCTGCG
References
15699190,16497325,30782632

5470621660C3AD6A3B82C4CEF5DAC3097EDC85B3

Page visits: 1051

Time of last update: 2023-01-27 20:44:58

Author of last update: Melvin.boenninger