yjbC

yjbC
168

general stress protein, required for survival of salt and paraquat stresses

locus
BSU_11490
Molecular weight
22.96 kDa
pI
5.14
Protein length
Gene length
function
survival of paraquat stress
product
unknown
essential
no
ec
null
synonyms
yjbC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,226,938  1,227,516
Phenotypes of a mutant
strongly impaired survival of salt stress [Pubmed|15805528]
The protein
[wiki|Domains]
[wiki|N-acetyltransferase domain] (aa 1-139) (according to UniProt)
Structure
[AF|O31601]
Expression and Regulation
Operons
genes
[gene|54D021424B31A8244F0F4B32EF9483CF27F90D43|yjbC]-[gene|2C6386E9A63F410558D168798D077DF91590F454|spx]
description
[Pubmed|10913081]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
regulatory mechanism
[protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]: repression, [Pubmed|17158660], in [regulon|protein:00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR regulon]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|17434969], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [PubMed|10913081], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|54D021424B31A8244F0F4B32EF9483CF27F90D43|yjbC]→[gene|2C6386E9A63F410558D168798D077DF91590F454|spx]

2022-05-03 09:51:54

Bzhu

26

bcf8f246067ad69ecde2a54b9dc1dd6aa6ba9fcd

F19AD43DD12EF67D1D851CD73B4FB79A8884DD1E

Biological materials
Mutant
MGNA-B150 (yjbC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1149 NBRP B. subtilis, Japan]
BKE11490 ([gene|54D021424B31A8244F0F4B32EF9483CF27F90D43|yjbC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGATTTGCTCCTTATGA,  downstream forward: _UP4_TAATTGAGAATAAGAACATA
BKK11490 ([gene|54D021424B31A8244F0F4B32EF9483CF27F90D43|yjbC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGATTTGCTCCTTATGA,  downstream forward: _UP4_TAATTGAGAATAAGAACATA
References
10913081,22582280,17158660,15805528,17158660,15805528,21815947

54D021424B31A8244F0F4B32EF9483CF27F90D43

Page visits: 2464

Time of last update: 2022-06-27 08:59:33

Author of last update: Melvin.boenninger