fpbN

fpbN
168

petrobactin (3.4-catecholate siderophore) [wiki|ABC transporter] (permease)

locus
BSU_03800
Molecular weight
34.75 kDa
pI
9.82
Protein length
Gene length
function
acquisition of iron
product
petrobactin  [wiki|ABC transporter] (permease)
essential
no
synonyms
fpbN, yclN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4606

This gene is a member of the following regulons

Gene
Coordinates
432,372  433,322
The protein
Catalyzed reaction/ biological activity
uptake of the siderophore petrobactin [Pubmed|19955416]
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|FecCD subfamily] (according to UniProt)
Structure
[AF|P94418]
[wiki|Localization]
cell  membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|552D4C42DCEA4625000160D2625711C61AB11661|fpbN]-[gene|EC63B5CDFDB4DF3A967ECEC40F2C44849311148B|fpbO]-[gene|473628F86C18FE9957841F3C8B45242C90CB341D|fpbP]-[gene|C1D6D188E5BD039F32427B2A58BBFC0CC173A476|fpbQ]
description
[Pubmed|19955416]
regulation
immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]) [Pubmed|29133393,12354229]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
Open in new tab

[gene|552D4C42DCEA4625000160D2625711C61AB11661|fpbN]→[gene|C1D6D188E5BD039F32427B2A58BBFC0CC173A476|fpbQ]

2022-11-24 10:03:09

Jstuelk

37

74ea5c8bb748d23ec3e0cc6fc1179cb8eab26119

67ED5A2606DC68A56E0956D7F4306EC013902C9F

Biological materials
Mutant
MGNA-C010 (yclN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2008 NBRP B. subtilis, Japan]
BKE03800 ([gene|552D4C42DCEA4625000160D2625711C61AB11661|fpbN]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTGCCTCCTTACATCC,  downstream forward: _UP4_TTTATGCTGTTAAGGAGAAA
BKK03800 ([gene|552D4C42DCEA4625000160D2625711C61AB11661|fpbN]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTGCCTCCTTACATCC,  downstream forward: _UP4_TTTATGCTGTTAAGGAGAAA
References
10092453,19955416,12354229,29133393

552D4C42DCEA4625000160D2625711C61AB11661

Page visits: 2593

Time of last update: 2022-11-27 06:37:15

Author of last update: Melvin.boenninger