SubtiWiki SubtiWiki
sapB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

sapB
168

a specific mutant activates alkaline phosphatase during sporulation independently of SigF and SigE

locus
BSU_06650
Molecular weight
25.79 kDa
pI
9.48
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
sapB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1285

This gene is a member of the following regulons

Gene
Coordinates
726,035  726,733
The protein
Protein family
mgtC/sapB family (single member, according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|552E27B8361EFD0EF0570FCD1B737A9D44DC9EAC|sapB]
description
[Pubmed|9043134]
Open in new tab

[gene|552E27B8361EFD0EF0570FCD1B737A9D44DC9EAC|sapB]

2021-12-06 12:33:49

ghost

4

c81425b51181d136f5aaa7d41656975500c96300

CBC8D8D561137A8A91CFDCAD883F94B76C7A4C2D

Biological materials
Mutant
BKE06650 ([gene|552E27B8361EFD0EF0570FCD1B737A9D44DC9EAC|sapB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACTTCCCCCTTCTCTAT,  downstream forward: _UP4_TAAAAGCCAATGGGACTGGA
BKK06650 ([gene|552E27B8361EFD0EF0570FCD1B737A9D44DC9EAC|sapB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACTTCCCCCTTCTCTAT,  downstream forward: _UP4_TAAAAGCCAATGGGACTGGA
References
9043134

552E27B8361EFD0EF0570FCD1B737A9D44DC9EAC

Page visits: 1023

Time of last update: 2022-01-15 12:54:44

Author of last update: Melvin.boenninger