sunI

sunI
168

bacteriocin producer immunity protein

locus
BSU_21490
Molecular weight
12.12 kDa
pI
9.22
Protein length
Gene length
function
immunity to sublancin
product
bacteriocin producer immunity protein
essential
no
synonyms
sunI, yolF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,269,988  2,270,305
Phenotypes of a mutant
essential (facultative, ''[gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]'' can be deleted if ''[gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]'' is also absent) [Pubmed|19047653], non-essential according to [Pubmed|28189581]
The protein
Catalyzed reaction/ biological activity
mediates immunity to sublancin [Pubmed|19047653]
Structure
[AF|O31989]
[wiki|Localization]
membrane anchored protein [Pubmed|19047653] [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]
description
[Pubmed|22383849]
Open in new tab

[gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]

2022-11-15 12:47:45

Jstuelk

15

70d1a1c465dd235dc1e37e7bdc025db7043b0ca6

1EF37A4BAC2C14AC6AA660728DDE5605AED551DC

Biological materials
Mutant
GP1565 ([gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]-[gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI], aphA3), available in [wiki|Jörg Stülke]'s lab
BKE21490 ([gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATAATCACTCTTTCTTA,  downstream forward: _UP4_TGAACATAAAAAAGTACCTT
BKK21490 ([gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATAATCACTCTTTCTTA,  downstream forward: _UP4_TGAACATAAAAAAGTACCTT
labs
[wiki|Jan Maarten van Dijl], Groningen, Netherlands
References
18763711,19047653,22383849,28189581,30808982

5599DC922B2B70364603FB5566314D808D82DC08

Page visits: 2959

Time of last update: 2022-11-27 08:16:16

Author of last update: Jstuelk