pksC

pksC
168

bacillaene synthase trans-acting acyltransferase

locus
BSU_17100
Molecular weight
32.31 kDa
pI
5.33
Protein length
Gene length
function
polyketide (bacillaene) synthesis
product
bacillaene synthase trans-acting acyltransferase
essential
no
synonyms
pksC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0331

This gene is a member of the following regulons

Gene
Coordinates
1,783,763  1,784,629
The protein
Catalyzed reaction/ biological activity
holo-[ACP] + malonyl-CoA --> CoA + malonyl-[ACP] (according to UniProt)
Protein family
fabD family (with [protein|BB8542A6444564B21FF5DB6E2C75192C6DA2DFB8|fabD] and [protein|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE], according to UniProt)
Structure
[PDB|5DZ6]
[AF|O34825]
Expression and Regulation
Operons
genes
[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
description
[Pubmed|22383849]
regulation
expressed during the transition from growth to stationary phase ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|24187085]
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|24187085], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: activation, [Pubmed|24187085], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
additional information
this is a very large operon comprising about 75 kb
Open in new tab

[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]→[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]

2022-11-28 20:51:32

Jstuelk

63

74BF817D9000509D225BBBCAC6C8A0A9EABEB843

1475C94AAA2C10C6BE3CA0873EFBD171EC2E2513

genes
[gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]-[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
description
[pubmed|22383849]
Open in new tab

[gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]→[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]

2022-11-25 15:41:08

Jstuelk

58

c851e07b7201353cf026d8929ea66cff6bbb92e2

D95CF77A7673AA84CC653095A1FB017D490049D6

Biological materials
Mutant
MGNA-A016 (pksC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/16 NBRP B. subtilis, Japan]
BKE17100 ([gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE17100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTCTCAAAGCCACCCT,  downstream forward: _UP4_TAAAGCATTTGCCCCTATGG
BKK17100 ([gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK17100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTCTCAAAGCCACCCT,  downstream forward: _UP4_TAAAGCATTTGCCCCTATGG
References
22383849,21505242,24187085,34460312,34557426

55C821F68B2E5F9F45CC2B2C9494D48D5C33266A

Page visits: 2297

Time of last update: 2022-12-06 03:30:27

Author of last update: Jstuelk