tetL

tetL
168

tetracycline resistance leader peptide

locus
BSU_40780
Molecular weight
2.16 kDa
pI
10.24
Protein length
Gene length
function
control of tetB expression
product
tetracycline resistance leader peptide
essential
no
ec
null
synonyms
tetL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

The protein
Structure
[AF|P23053]
Expression and Regulation
Operons
genes
[gene|55C9FA5282B213915C164B46119C482D03491381|tetL]-[gene|4B900A64A96696F48BB0C2DC3B0884CD2F5E298B|tetB]
description
(according to [http://dbtbs.hgc.jp/COG/prom/tetLB.html DBTBS]) null
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2844262], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|55C9FA5282B213915C164B46119C482D03491381|tetL]→[gene|4B900A64A96696F48BB0C2DC3B0884CD2F5E298B|tetB]

2022-12-02 05:58:41

ghost

23

63c9a5af3eca26ece65b2cd2d340c7272e31a94e

A09189BCE1C3051FC5DFEEAC90EE8300EB8336CB

Biological materials
Mutant
BKE40780 (Δ[gene|55C9FA5282B213915C164B46119C482D03491381|tetL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATAACTCCCCCTACAT,  downstream forward: _UP4_TAAACTGCGTCTGCCCTCAT
BKK40780 (Δ[gene|55C9FA5282B213915C164B46119C482D03491381|tetL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATAACTCCCCCTACAT,  downstream forward: _UP4_TAAACTGCGTCTGCCCTCAT
labs
[wiki|David Bechhofer], Mount Sinai School, New York, USA [http://www.mountsinai.org/Research/Centers%20Laboratories%20and%20Programs/Bechhofer%20Laboratory?citype=Physician&ciid=Bechhofer%20David%20H%201255565 Homepage]
References
2844262

55C9FA5282B213915C164B46119C482D03491381

Page visits: 1161

Time of last update: 2022-12-03 14:18:22

Author of last update: Bzhu