SubtiWiki SubtiWiki
rplI

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

rplI
168

ribosomal protein BL9

locus
BSU_40500
Molecular weight
16.21 kDa
pI
9.96
Protein length
Gene length
function
translation
product
ribosomal protein BL9
essential
no
synonyms
rplI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0359

This gene is a member of the following regulons

Gene
Coordinates
4,163,197  4,163,646
The protein
Protein family
bacterial [wiki|ribosomal protein] bL9 family (single member, according to UniProt)
Structure
[PDB|1DIV] (Geobacillus stearothermophilus)
[PDB|3J9W] (the [wiki|ribosome]) [Pubmed|25903689]
Additional information
this ribosomal protein is lacking in some organisms with very small genomes [pubmed|33753464]
Expression and Regulation
Operons
genes
[gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]
description
[Pubmed|22383849]
Open in new tab

[gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]

2021-11-10 23:07:22

Jstuelk

6

9719aa675f1687e98876d458754bd37d07793d94

898C3DE7EFA8B11FFFC6A8E5F1017E9BE94EAC6E

genes
[gene|6640C754249DD8E4E15889CC838F5D04A682BF58|yybS]-[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]-[gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]
description
[Pubmed|22383849]
additional information
term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yybS'' [Pubmed|27120414]
there is an [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-dependent antisense RNA ([gene|0098E3A710385B31987947E6206A89000CA32F55|S1559]) to [gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP] [pubmed|22956758]
Open in new tab

[gene|6640C754249DD8E4E15889CC838F5D04A682BF58|yybS]→[gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]

2022-01-03 08:57:13

Jstuelk

12

5C9AFECBF28951E728207E104CAD078590852270

8A05783D8D0BA185AE37B5649C8B5E3E55F05A22

Biological materials
Mutant
BKE40500 ([gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTCATCTCTGTACGCCTCC,  downstream forward: _UP4_TAATAGAAAAGAGGCTTGGA
BKK40500 ([gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTCATCTCTGTACGCCTCC,  downstream forward: _UP4_TAATAGAAAAGAGGCTTGGA
References
19653700,25903689,33753464

56737276B364EC0BC7391F1BA15F225C352ED905

Page visits: 1086

Time of last update: 2022-01-15 03:03:31

Author of last update: Jstuelk