fecC

fecC
168

iron/ citrate [wiki|ABC transporter] (binding protein)

locus
BSU_07520
Molecular weight
34.87 kDa
pI
7.88
Protein length
Gene length
function
iron uptake
product
iron/ citrate [wiki|ABC transporter] (binding protein)
essential
no
synonyms
fecC, yfmC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4594

This gene is a member of the following regulons

Gene
Coordinates
825,787  826,734
Phenotypes of a mutant
poor growth with the Fe(III)-dicitrate as single source of iron [Pubmed|23220087]
The protein
Protein family
[wiki|Bacterial solute-binding protein 8 family] (according to UniProt)
[wiki|Domains]
[wiki|Fe/B12 periplasmic-binding domain] (aa 60-315) (according to UniProt)
Structure
[PDB|3EIW] (from ''Staphylococcus aureus'', the [protein|569510093E5B69A0368205920A21A81CADF030E9|fecC]-[protein|1469148C83B1704E721652203EA31F0E2C33FDC6|yhfQ] complex, 46% identity) [Pubmed|19400778]
[AF|O34348]
Paralogous protein(s)
[protein|1469148C83B1704E721652203EA31F0E2C33FDC6|yhfQ]
[wiki|Localization]
associated to the membrane (via [protein|BDAA56484E05DA3C1CB0CA09873A365657999679|fecD]-[protein|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|fecE]) [Pubmed|10092453,18763711]
extracellular (signal peptide) [Pubmed|18957862], lipid modification as retention signal
Expression and Regulation
Operons
genes
[gene|13FEC673232C5946C6EA7E9DD3AA6AA1A57269E1|yfmB]-[gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]
description
[Pubmed|22383849]
regulation
induced upon iron starvation ([protein|search|Fur]) [Pubmed|16672620,12354229]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [Pubmed|16672620,12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
Open in new tab

[gene|13FEC673232C5946C6EA7E9DD3AA6AA1A57269E1|yfmB]→[gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]

2022-11-18 00:49:30

ghost

17

ff6d4fec33ba47c73e471c19cfc516b3ab0a2b4a

1A70472954B4F8249ED6A3AD95C2EC7D308D7376

genes
[gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]-[gene|BDAA56484E05DA3C1CB0CA09873A365657999679|fecD]-[gene|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|fecE]-[gene|E76640F895261DA34AD2342B54B43D11857AEA9A|fecF]
description
[Pubmed|16672620]
regulation
immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]) [Pubmed|29133393,16672620,12354229]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [Pubmed|16672620,12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
Open in new tab

[gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]→[gene|E76640F895261DA34AD2342B54B43D11857AEA9A|fecF]

2022-11-28 13:17:22

Jstuelk

20

08d0c1575e8a6211c799093cfc6ee3a9c3135a88

49520E691347BD8533B6CD8A50C6130F3DA7A9DB

genes
[gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]
description
[Pubmed|22383849]
regulation
induced upon iron starvation ([protein|search|Fur]) [Pubmed|16672620,12354229]
Open in new tab

[gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]

2022-11-22 06:56:53

ghost

17

2792e244ff65223ceeabb056505d6c58b76267eb

D6BE706E8642A3B88A9E7C5351BC973C150950E2

Biological materials
Mutant
MGNA-C246 (yfmC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2244 NBRP B. subtilis, Japan]
BKE07520 ([gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCATTCTTCCTTTTTT,  downstream forward: _UP4_TAGGACAAATGAGAAGCGAG
BKK07520 ([gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCATTCTTCCTTTTTT,  downstream forward: _UP4_TAGGACAAATGAGAAGCGAG
References
10092453,16672620,12354229,18957862,18763711,23220087,23199363,22383849,19400778,29133393

569510093E5B69A0368205920A21A81CADF030E9

Page visits: 2777

Time of last update: 2022-11-28 22:53:43

Author of last update: Melvin.boenninger