nprB

nprB
168

extracellular neutral protease B, required for the function of the [protein|330CB6A25181F7AFD3C63F73CA21A3428882D100|yitM] toxin

locus
BSU_11100
Molecular weight
59.17 kDa
pI
5.32
Protein length
Gene length
function
protection of B. subtilis biofilms against competitors
product
extracellular neutral protease B
essential
no
synonyms
nprB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3227

This gene is a member of the following regulons

Gene
Coordinates
1,186,037  1,187,653
The protein
Protein family
peptidase M4 family (with [protein|309EAC680ABFF0B736E01F0B9BDFBB2FCBDB1BBF|nprE], according to UniProt)
Structure
[PDB|5A3Y] (thermolysin, 44% identity) [pubmed|26527148]
[AF|P39899]
Paralogous protein(s)
[protein|309EAC680ABFF0B736E01F0B9BDFBB2FCBDB1BBF|nprE]
[wiki|Localization]
secreted (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|57139471EB143F6DCCF092DAD0FBB43B0D50D948|nprB]
description
[pubmed|22383849]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [pubmed|31622331], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
Open in new tab

[gene|57139471EB143F6DCCF092DAD0FBB43B0D50D948|nprB]

2022-11-28 10:09:27

Jstuelk

26

49847863c41183fa03322f04fd34fde2b93ac8fe

92860007A5C300C6070C2211F03B9216D3956623

Biological materials
Mutant
KO7 (''nprE  aprE  epr  mpr  nprB  vpr  bpr''), available as BGSC 1A1133
BKE11100 ([gene|57139471EB143F6DCCF092DAD0FBB43B0D50D948|nprB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAACACCACATCCTTCCT,  downstream forward: _UP4_TGAGCAAACAAAAACAGTCA
BKK11100 ([gene|57139471EB143F6DCCF092DAD0FBB43B0D50D948|nprB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAACACCACATCCTTCCT,  downstream forward: _UP4_TGAGCAAACAAAAACAGTCA
References
Reviews
34410368
Original Publications
24115457,26527148,31622331

57139471EB143F6DCCF092DAD0FBB43B0D50D948

Page visits: 1870

Time of last update: 2022-11-28 17:27:35

Author of last update: Jstuelk