manP

manP
168

mannose-specific permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIIBCA of the [category|SW.1.2.2|PTS], [category|SW.3.4.3|Trigger enzyme], control of [protein|F273002AF97D87BB025B4F014C328C5592EAD621|manR] activity

locus
BSU_12010
Molecular weight
61.81 kDa
pI
6.72
Protein length
Gene length
function
mannose uptake and phosphorylation, control of [protein|F273002AF97D87BB025B4F014C328C5592EAD621|manR] activity
product
mannose-specific [category|SW.1.2.2|PTS], EIIBCA
essential
no
synonyms
manP, yjdD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1762

This gene is a member of the following regulons

Gene
Coordinates
1,272,725  1,274,677
The protein
Catalyzed reaction/ biological activity
transport  and concomitant phosphorylation of mannose
D-mannose + Nπ-phospho-L-histidyl-[protein] --> D-mannose 6-phosphate + L-histidyl-[protein] (according to UniProt)
Protein family
[category|SW.1.2.2|PTS] permease, fructose/ mannitol family [Pubmed|10627040]
[wiki|Domains]
3 [wiki|PTS EIIC domain]s type-2 (aa 1-98, aa 123-456, aa 504-649) (according to UniProt)
Structure
[PDB|2R48] (IIA domain)
[PDB|2R4Q] ([protein|973C3D3FBFDCA095A760C5F49A96D8BE48771014|fruA], IIB domain, 56% identity)
[AF|O31645]
Modification
phosphorylation on Ser-365 [Pubmed|17218307]
Paralogous protein(s)
[protein|973C3D3FBFDCA095A760C5F49A96D8BE48771014|fruA]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]-[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]-[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF]
description
[Pubmed|20139185]
regulation
induced by mannose ([protein|search|ManR]) [Pubmed|20139185]
regulatory mechanism
[protein|F273002AF97D87BB025B4F014C328C5592EAD621|manR]: activation, in the presence of mannose and absence of glucose [Pubmed|20139185], in [regulon|protein:F273002AF97D87BB025B4F014C328C5592EAD621|manR regulon]
RNA switch: termination/antitermination, expession may be controlled by a potential [wiki|RNA switch] located in the 5' untranslated region of the [gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]-[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]-[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF] mRNA between [gene|E26C70893C5D677C816C814558CC42F90B920087|manA] and [gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF], in [regulon|other_regulator:RNA switch|RNA switch]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|20139185], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]→[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF]

2022-11-21 20:21:22

ghost

33

1daceac68a02c55c027e015b7db7fb6acdda20c4

1E7704E8FB9878FD0651ED97B4D5E5AC91AB92F5

Biological materials
Mutant
MGNA-A270 (yjdD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/270 NBRP B. subtilis, Japan]
BKE12010 ([gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE12010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGGAAACCTCCTTTAAA,  downstream forward: _UP4_ATCGAATAAAGCGGGGGATT
BKK12010 ([gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK12010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGGAAACCTCCTTTAAA,  downstream forward: _UP4_ATCGAATAAAGCGGGGGATT
References
10627040,17218307,10627040,20139185,23033921,23551403,26238998

575CEC5C5C0458DC86A74F24654AC6990CB1E732

Page visits: 5515

Time of last update: 2022-12-01 02:15:53

Author of last update: Melvin.boenninger