SubtiWiki SubtiWiki
mdxE

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

mdxE
168

maltodextrin [wiki|ABC transporter], binding protein

locus
BSU_34610
Molecular weight
45.44 kDa
pI
4.91
Protein length
Gene length
function
maltodextrin utilization
product
maltodextrin [wiki|ABC transporter], binding protein
essential
no
synonyms
mdxE, yvdG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2182

This gene is a member of the following regulons

Gene
Coordinates
3,554,553  3,555,806
The protein
Protein family
[wiki|Bacterial solute-binding protein 1 family] (according to UniProt)
Structure
[PDB|5TU0] (from Listeria monocytogenes, 67% identity)
Paralogous protein(s)
[protein|D4A5A878F87EBC14C02824233155CEBACEB41343|ganS]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A|yvdE]-[gene|A577441DE4ABAF624D507DB80FBED2A652BCF385|yvdF]-[gene|5771E1976D986638B13ADDE97EDE32709E355923|mdxE]-[gene|EA2DD9892C1128ADCD6C8BC61248EBE45339E6D6|mdxF]-[gene|D72CFFE8ED3EC0280AE92C05A136D66ED1F62251|mdxG]-[gene|68C6FD5D4D9491EE15A5015447959A45C36EA702|yvdJ]-[gene|5F615BB886EC4F7000AAD42258DB8E47616552DE|yvdK]-[gene|6E5AB4620F9A896C32CD77AF314C67035814AE0A|malL]-[gene|CAFAE305B1771DD89E81F75A6713161393BE99A0|pgcM]
description
[Pubmed|16707683]
regulation
induced in the presence of maltose [Pubmed|9573215]
Open in new tab

[gene|EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A|yvdE]→[gene|CAFAE305B1771DD89E81F75A6713161393BE99A0|pgcM]

2022-01-25 06:06:27

ghost

12

875dd090fab06d126bf7206081d457b6a5e12492

6EDA4FDB63800BE601694138B9C35457B6878679

Biological materials
Mutant
MGNA-B627 (yvdG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1626 NBRP B. subtilis, Japan]
BKE34610 ([gene|5771E1976D986638B13ADDE97EDE32709E355923|mdxE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTTTCCTCCTTCTA,  downstream forward: _UP4_TAAAACGGCGGGATAGCGTC
BKK34610 ([gene|5771E1976D986638B13ADDE97EDE32709E355923|mdxE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTTTCCTCCTTCTA,  downstream forward: _UP4_TAAAACGGCGGGATAGCGTC
References
10092453,16707683

5771E1976D986638B13ADDE97EDE32709E355923

Page visits: 1183

Time of last update: 2022-01-28 02:55:53

Author of last update: Melvin.boenninger