ureA

ureA
168

urease (gamma subunit)

locus
BSU_36660
Molecular weight
11.32 kDa
pI
4.98
Protein length
Gene length
function
utilization of urea as alternative nitrogen source
product
urease (gamma subunit)
essential
no
ec
3.5.1.5
synonyms
ureA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0831

This gene is a member of the following regulons

Gene
Coordinates
3,768,791  3,769,108
The protein
Catalyzed reaction/ biological activity
2 H+ + H2O + urea --> CO2 + 2 NH4+ (according to UniProt)
Protein family
urease gamma subunit family (single member, according to UniProt)
Structure
[PDB|2FVH] (from ''Mycobacterium tuberculosis'', 57% identity, 62% similarity)
[AF|P75030]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|63CF8C8BBCE39BD585DD5F6C8BBD95E12B500AE6|ywzF]-[gene|1D9596609AEF10456041918BD592E49466D93B1F|ywzE]-[gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]-[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]-[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]
description
[Pubmed|22383849]
Open in new tab

[gene|63CF8C8BBCE39BD585DD5F6C8BBD95E12B500AE6|ywzF]→[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]

2022-11-24 09:28:16

Jstuelk

42

3a346978aa36c52246d401910c25c973229ebcd4

2EC7A375287DC2C117653A7AF0CE944D5ED3C17E

genes
[gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]-[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]-[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]
description
[Pubmed|9287005]
regulation
induced by nitrogen limitation ([protein|search|GlnR], [protein|search|TnrA]) [Pubmed|9287005]
regulatory mechanism
[protein|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]: repression, [Pubmed|9287005], in [regulon|protein:641C4BDD9702804642E1753A9C779E80FABB3919|glnR regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|9287005], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|52C1601482C26400A524E880334BB801F832D6ED|pucR]: activation, [Pubmed|12374841], in [regulon|protein:52C1601482C26400A524E880334BB801F832D6ED|pucR regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|9287005,12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9287005], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|9287005], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]→[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]

2022-11-23 04:19:25

ghost

26

2424bd660c3e7e5f26264d885ccc1b3206a82722

869154A4A6E14A6F76FB429E5FEE8D2B62E5A9F8

Biological materials
Mutant
BKE36660 ([gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE36660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTAGTCCTCCTTCTT,  downstream forward: _UP4_CCAATTTCTGCGGAGGTGAA
BKK36660 ([gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK36660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTAGTCCTCCTTCTT,  downstream forward: _UP4_CCAATTTCTGCGGAGGTGAA
References
Reviews
23539618,19363030
Original Publications
12374841,18083814,12618455,9287005,9287005,12374841,9287005,1670935,16199586,25755103

57B6D70B2570C308377B301EC2AF6C232233FD46

Page visits: 9403

Time of last update: 2022-11-28 15:10:51

Author of last update: Melvin.boenninger