SubtiWiki SubtiWiki
abh
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

abh
168

transcriptional regulator of transition state genes

locus
BSU_14480
Molecular weight
10.12 kDa
pI
5.75
Protein length
Gene length
function
regulation of gene expression during the transition from growth to stationary phase
product
transcriptional regulator
essential
no
synonyms
abh, ylxT, yzaA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2002

This gene is a member of the following regulons

Gene
Coordinates
1,517,865  1,518,143
Phenotypes of a mutant
inactivation of ''[gene|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]'' results in sensitivity against beta-lactam antibiotics that can be restored by induction of ''[gene|920F91E748EE079FF864011D9052B073567C41E4|slrR]'' expression or by inactivation of the genes encoding major autolysins (''[gene|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC], [gene|E8B88CBE4F9121DFEEF099D7947CD1E1AE656160|lytF]'') [Pubmed|22211522]
The protein
[wiki|Domains]
[wiki|SpoVT-AbrB domain] (aa 5-50) (according to UniProt)
Structure
[PDB|2FY9] (N-terminal DNA recognition domain)
Paralogous protein(s)
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT], (only the N-terminal domains (aa 1 through 50) are conserved between SpoVT and the two paralogues)
Expression and Regulation
Operons
genes
[gene|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]
description
[Pubmed|8002614]
regulation
expression is reduced in a [protein|search|SigV] mutant [Pubmed|21926231]
sigma factors
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|9636707], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|19465659], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV]: sigma factor, in [regulon|protein:D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV regulon]
Open in new tab

[gene|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]

2021-09-18 05:52:55

ghost

5

9b531400641858d6e85dc873f91daf8eb915ad0c

C3D37B201B7AE7BA5FC386CBFBE89634EAC0E115

Biological materials
Mutant
BKE14480 ([gene|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACCCTTCTTCCTT,  downstream forward: _UP4_TAAAATTATGCTAAAAAAGG
BKK14480 ([gene|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACCCTTCTTCCTT,  downstream forward: _UP4_TAAAATTATGCTAAAAAAGG
labs
[wiki|Mark Strauch], Baltimore, USA [http://lifesciences.umaryland.edu/Pages/faculty_profile.aspx?ID=212 homepage]
References
Other original publications
9636707,19465659,16306698,16702211,17720793,19767430,8002614,22211522,20844865,21926231
The [wiki|Abh regulon]
20817675

5872812AB61E92E2944E926915EB7FEE71BFA6D5

Page visits: 2291

Time of last update: 2021-09-19 20:55:30

Author of last update: Melvin.boenninger