ybaR

ybaR
168

fumarate transporter

locus
BSU_01580
Molecular weight
51.01 kDa
pI
7.9
Protein length
Gene length
function
uptake of fumarate
product
fumarate:proton symporter
essential
no
synonyms
ybaR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0659

This gene is a member of the following regulons

Gene
Coordinates
177,083  178,519
The protein
Protein family
SLC26A/SulP transporter (TC 2.A.53) family (with [protein|7028580E25DD6C1D49A14F29DDCC02012F94FED7|yvdB], according to UniProt)
[wiki|Domains]
[wiki|STAS domain] (aa 389-478) (according to UniProt)
Structure
[PDB|5DA0] (from ''Deinococcus radiodurans'', 63% identity) [Pubmed|26367249]
[AF|P55189]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|58B61B18D1C69BB9DCAB5EDFBFB3A498AA121386|ybaR]
description
[Pubmed|22383849]
Open in new tab

[gene|58B61B18D1C69BB9DCAB5EDFBFB3A498AA121386|ybaR]

2022-11-30 02:31:21

Jstuelk

24

7d3d79d446200205333a7d3e4153acce2e863501

6FE6C55FF42D34D480D39582F1548F8611173FD2

Biological materials
Mutant
MGNA-B948 (ybaR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1947 NBRP B. subtilis, Japan]
BKE01580 ([gene|58B61B18D1C69BB9DCAB5EDFBFB3A498AA121386|ybaR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATATAACGACTCCTTTT,  downstream forward: _UP4_TAAAATAGAGAAGCCCAGAT
BKK01580 ([gene|58B61B18D1C69BB9DCAB5EDFBFB3A498AA121386|ybaR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATATAACGACTCCTTTT,  downstream forward: _UP4_TAAAATAGAGAAGCCCAGAT
References
26367249

58B61B18D1C69BB9DCAB5EDFBFB3A498AA121386

Page visits: 1080

Time of last update: 2022-12-02 11:09:54

Author of last update: Melvin.boenninger