yhgD

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yhgD
168

similar to transcriptional regulator ([wiki|TetR family])

locus
BSU_10150
Molecular weight
21.65 kDa
pI
7.24
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yhgD, yixD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1309

This gene is a member of the following regulons

Gene
Coordinates
1,089,755  1,090,330
The protein
Protein family
[wiki|TetR family]
[wiki|Domains]
[wiki|HTH tetR-type domain] (aa 3-63) (according to UniProt)
Structure
[PDB|5K7F] (from Myxococcus xanthus, 24% identity) [pubmed|27940564]
[AF|P32398]
Expression and Regulation
Operons
genes
[gene|591C37CE3A583ADFC3006A8D1C9D07FA4F8F624C|yhgD]-[gene|8CA084B7BAA4969534DFEFBAFE31D25125354630|yhgE]
description
[Pubmed|22383849]
Open in new tab

[gene|591C37CE3A583ADFC3006A8D1C9D07FA4F8F624C|yhgD]→[gene|8CA084B7BAA4969534DFEFBAFE31D25125354630|yhgE]

2022-05-07 21:52:57

Jstuelk

12

c9b3e85755f0e3b48537445021d8e507ef6597bf

C438D8B67621370FD549DB9001151E22A7A39500

Biological materials
Mutant
MGNA-B504 (yhgD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1503 NBRP B. subtilis, Japan]
BKE10150 ([gene|591C37CE3A583ADFC3006A8D1C9D07FA4F8F624C|yhgD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10150 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTATTCACCTCGAAAC,  downstream forward: _UP4_TAGATAATCCTTTCTCTTTG
BKK10150 ([gene|591C37CE3A583ADFC3006A8D1C9D07FA4F8F624C|yhgD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10150 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTATTCACCTCGAAAC,  downstream forward: _UP4_TAGATAATCCTTTCTCTTTG
References
Reviews
24006471
Research papers
27940564

591C37CE3A583ADFC3006A8D1C9D07FA4F8F624C

Page visits: 1704

Time of last update: 2022-05-26 03:48:43

Author of last update: Melvin.boenninger