fabL

fabL
168

enoyl-acyl carrier protein reductase

locus
BSU_08650
Molecular weight
27.03 kDa
pI
5.97
Protein length
Gene length
function
fatty acid biosynthesis
product
enoyl-acyl carrier protein reductase
essential
no
synonyms
fabL, yfhR, ygaA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1028

This gene is a member of the following regulons

Gene
Coordinates
937,079  937,831
The protein
Catalyzed reaction/ biological activity
2,3-saturated acyl-[ACP] + NADP+ --> (2E)-enoyl-[ACP] + H+ + NADPH (according to UniProt)
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
Structure
[PDB|3OIC] [Pubmed|21185310]
[AF|P71079]
Paralogous protein(s)
[protein|60A519E4C1485B9F5BF36E83EDE884B396857CB4|fabI], one of the two proteins has to be present for viability [Pubmed|17114254]
[protein|B6FF689E65906186F3576B378650D713DB84EDDA|ycdF], (31.6%)
[protein|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF], (30.1%)
[protein|4DEFC2998464BF8327578C36A13A10DD277F991E|ykvO], (31,8%)
Expression and Regulation
Operons
genes
[gene|5964B6E817260DA7937796DDFA753A665A04D650|fabL]-[gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]
description
[Pubmed|10463184]
regulation
repressed by casamino acids [Pubmed|12107147]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: repression, in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
[protein|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP]: repression, in [regulon|protein:BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10463184], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|5964B6E817260DA7937796DDFA753A665A04D650|fabL]→[gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]

2022-11-22 15:53:17

ghost

32

67265ff3bb89564e24e307e1cd5eb4bb4dbff57c

9C9F76530F9E01DE8E0DFAA748E25E67C55A5D59

genes
[gene|B62083CF18FC4C796D95B960CF62FA963FC26CDE|mutY]-[gene|5964B6E817260DA7937796DDFA753A665A04D650|fabL]-[gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]
description
[Pubmed|10463184]
regulation
expression is constitutive throughout growth [Pubmed|20971907]
regulatory mechanism
[protein|BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP]: repression, in [regulon|protein:BB4007ADF92649730C9F9A26FD082ABC8CFA1E48|yfhP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10463184], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|1900507], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|B62083CF18FC4C796D95B960CF62FA963FC26CDE|mutY]→[gene|25FC6EEC336387285724F75E304B76A2A3E1C056|sspE]

2022-11-26 06:07:12

ghost

42

3a7a008cdfb01ec3e3352da847749371e7eede7c

C3DBF827F212448AA1AC6115B8D2A94E11E4693A

Biological materials
Mutant
MGNA-C324 (yfhR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2322 NBRP B. subtilis, Japan]
BKE08650 ([gene|5964B6E817260DA7937796DDFA753A665A04D650|fabL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCCTCATCTCCTTG,  downstream forward: _UP4_TAAAAATTTTTAAAAAAGAG
BKK08650 ([gene|5964B6E817260DA7937796DDFA753A665A04D650|fabL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCCTCATCTCCTTG,  downstream forward: _UP4_TAAAAATTTTTAAAAAAGAG
References
Reviews
15952903,17919287
Original Publications
17114254,10463184,15699190,8755877,11007778,21185310,25527535

5964B6E817260DA7937796DDFA753A665A04D650

Page visits: 3232

Time of last update: 2022-11-28 12:51:13

Author of last update: Melvin.boenninger