comP

comP
168

two-component sensor kinase, detects extracellular [protein|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX]

locus
BSU_31690
Molecular weight
89.13 kDa
pI
8
Protein length
Gene length
function
regulation of genetic competence and quorum sensing
product
two-component sensor kinase
essential
no
synonyms
comP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4585

This gene is a member of the following regulons

Gene
Coordinates
3,253,529  3,255,838
Phenotypes of a mutant
the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants due to loss of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU] phosphorylation and concomitant reduced expression of the ''[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]'' operon [Pubmed|24296669]
The protein
Catalyzed reaction/ biological activity
autophosphorylation
phosphorylation of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA] when bound to [protein|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX]
ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
[wiki|Domains]
eight transmembrane segments
[wiki|Histidine kinase domain] (aa 571-769) (according to UniProt)
Structure
[AF|Q99027]
Modification
autophosphorylation on a His residue
Effectors of protein activity
[protein|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX] (extracellular)
[wiki|Localization]
cell membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|comQ]-[gene|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX]-[gene|5A00E233F0B5A0DAB18D2ECC55527F1911987F86|comP]-[gene|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]-[gene|015989AAB862E418C944AB35DA3605863F059CE9|yuxO]
description
[Pubmed|22383849]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2507523], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|comQ]→[gene|015989AAB862E418C944AB35DA3605863F059CE9|yuxO]

2022-12-02 09:08:04

Jstuelk

45

150fea5ac7a55e0a32a0fafb306d0c860c9a2be7

E73017881E40042997BB444071E259402A0F5D1F

Biological materials
Mutant
BKE31690 ([gene|5A00E233F0B5A0DAB18D2ECC55527F1911987F86|comP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE31690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATATTAATCCACCTATTA,  downstream forward: _UP4_TAATGGATTTATAACGGAAA
BKK31690 ([gene|5A00E233F0B5A0DAB18D2ECC55527F1911987F86|comP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK31690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATATTAATCCACCTATTA,  downstream forward: _UP4_TAATGGATTTATAACGGAAA
References
Reviews
12576575,30218468
Original Publications
11133937,8643670,12067344,10094672,10419951,2116363,9274030,18763711,24296669,24130811,24425772,24788106,25757097,26787913,26927849,29038467

5A00E233F0B5A0DAB18D2ECC55527F1911987F86

Page visits: 2671

Time of last update: 2022-12-07 20:44:05

Author of last update: Melvin.boenninger