uxaC

uxaC
168

glucuronate isomerase (D-glucuronate, D-galacturonate)

locus
BSU_12300
Molecular weight
54.44 kDa
pI
5.17
Protein length
Gene length
function
hexuronate utilization
product
glucuronate isomerase (D-glucuronate, D-galacturonate)
essential
no
ec
5.3.1.12
synonyms
uxaC, yjmA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1904

This gene is a member of the following regulons

Gene
Coordinates
1,300,450  1,301,871
The protein
Catalyzed reaction/ biological activity
D-glucuronate --> D-fructuronate (according to UniProt)
aldehydo-D-galacturonate --> keto-D-tagaturonate (according to UniProt)
Protein family
[wiki|metallo-dependent hydrolases superfamily] (according to UniProt)
Structure
[PDB|3IAC] (from Salmonella typhimurium, 49% identity)
[AF|O34808]
Expression and Regulation
Operons
genes
[gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]-[gene|59CD3E4C24326542D9C85BB6FE64FBF49869EB55|yjmB]-[gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]-[gene|CC55984E31C5698668CCCD4AC6E2210B2B41ACAB|yjmD]-[gene|A0A6D36BEC397345A1D17E6A7C34E1F612FD46C7|uxuA]-[gene|B886E504A767343042DE9BF4E23E6798D124A2CF|yjmF]-[gene|6D08E897DD697523FD0720704A25AD4472075B6C|exuT]-[gene|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]-[gene|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB]-[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]
description
[Pubmed|9882655]
regulation
induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
regulatory mechanism
[protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]: repression, in the absence of inducer, in [regulon|protein:69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9882655], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]→[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]

2022-11-17 14:10:32

ghost

20

0325999ea185bfaaf2dea87e1701479c52256033

A15F6E93B04DC8C4B59B7976DAC34CE9AC0B8E51

Biological materials
Mutant
MGNA-A365 (yjmA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/365 NBRP B. subtilis, Japan]
BKE12300 ([gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE12300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTCACCGTCTTTCA,  downstream forward: _UP4_TAACAAAGTGTCCGCTCAGT
BKK12300 ([gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK12300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTCACCGTCTTTCA,  downstream forward: _UP4_TAACAAAGTGTCCGCTCAGT
References
9579062,22900538,9579062,9882655,10666464

5A0C29C7E218701727523885D01A48D02266B421

Page visits: 1486

Time of last update: 2022-11-28 22:08:31

Author of last update: Melvin.boenninger