SubtiWiki SubtiWiki
aadK
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

aadK
168

aminoglycoside 6-adenylyltransferase

locus
BSU_26790
Molecular weight
33.75 kDa
pI
4.76
Protein length
Gene length
function
resistance to streptomycin
product
aminoglycoside 6-adenylyltransferase
essential
no
ec
null
synonyms
aadK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,735,682  2,736,536
The protein
Structure
[PDB|2PBE]
Expression and Regulation
Operons
genes
[gene|5A867E29385030DBA3871C39405C89C623F9399F|aadK]-[gene|E02EB2B08203501E6DD2D1FB24BDA59058F87FB9|bstE]
description
[Pubmed|22383849]
Open in new tab

[gene|5A867E29385030DBA3871C39405C89C623F9399F|aadK]→[gene|E02EB2B08203501E6DD2D1FB24BDA59058F87FB9|bstE]

2021-09-18 05:53:14

Jstuelk

5

d0a929d797571fee4b92239f812c4854ad27b610

43DCFB8E1F1DFE95A809B5FAB3473BFCF8AC5EA1

Biological materials
Mutant
BKE26790 ([gene|5A867E29385030DBA3871C39405C89C623F9399F|aadK]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACATGTTCCTCCGTTT,  downstream forward: _UP4_TGATAAGAATATAGGATTGT
BKK26790 ([gene|5A867E29385030DBA3871C39405C89C623F9399F|aadK]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACATGTTCCTCCGTTT,  downstream forward: _UP4_TGATAAGAATATAGGATTGT
References
2550327,8293959

5A867E29385030DBA3871C39405C89C623F9399F

Page visits: 1594

Time of last update: 2021-09-18 05:53:08

Author of last update: Bzhu