SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


sulfite reductase (NADPH2) (alpha subunit)

Molecular weight
67.08 kDa
Protein length
Gene length
sulfite reduction
sulfite reductase (NADPH2)
cysJ, yvgQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0369

This gene is a member of the following regulons

3,432,339 3,434,156
Phenotypes of a mutant
unable to grow with sulfate or sulfite as the only sulfur source [Pubmed|12169591]
defective in the the ability to support the growth of ''Synechococcus leopoliensis'' CCAP1405/1 on agar media [Pubmed|25875741]
The protein
Catalyzed reaction/ biological activity
3 H2O + hydrogen sulfide + 3 NADP+ --> 4 H+ + 3 NADPH + sulfite (according to UniProt)
[wiki|Flavodoxin-like domain] (aa 68-206) (according to UniProt)
[wiki|FAD-binding FR-type domain] (aa 235-454) (according to UniProt)
FMN [Pubmed|21635694]
FAD [Pubmed|21635694]
[PDB|5GXU] (from Arabidopsis, 32% identity)
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
induced by sulfite, sulfate, and thiosulfate ([protein|search|CysL]) [Pubmed|12169591]
regulatory mechanism
[protein|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|cysL]: activation, [Pubmed|12169591], in [regulon|protein:FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|cysL regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12169591], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2021-10-16 17:03:25





Biological materials
1A802 ( ''cysJ''::''kan''), [Pubmed|11445163], available at [ BGSC]
1A934 ( ''cysJ''::''kan''), [Pubmed|12169591], available at [ BGSC]
BKE33440 ([gene|5A99F57DF0DDF5A129C3702E97621232A8173C22|cysJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTATCCACCTCACAAA, downstream forward: _UP4_TGATTTGACTTGAAAGGAGT
BKK33440 ([gene|5A99F57DF0DDF5A129C3702E97621232A8173C22|cysJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTATCCACCTCACAAA, downstream forward: _UP4_TGATTTGACTTGAAAGGAGT


Page visits: 1500

Time of last update: 2022-01-17 21:35:28

Author of last update: Melvin.boenninger