yfkC

yfkC
168

mechanosensitive channel, similar to MscS

locus
BSU_07940
Molecular weight
32.05 kDa
pI
5.29
Protein length
Gene length
function
resistance to osmotic downshock
product
mechanosensitive channel, similar to MscS
essential
no
synonyms
yfkC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0668

This gene is a member of the following regulons

Gene
Coordinates
867,164  868,006
Phenotypes of a mutant
a [protein|5ACE71EBBDCEB0C534A91DE303FD8069BEFDD6A1|yfkC]-R42W gain of function mutation facilitates the adaptation a strain lacking c-di-AMP to growth on medium containing glutamate [pubmed|33481774]
The protein
Catalyzed reaction/ biological activity
the [protein|5ACE71EBBDCEB0C534A91DE303FD8069BEFDD6A1|yfkC]-R42W gain of function variant converts [protein|5ACE71EBBDCEB0C534A91DE303FD8069BEFDD6A1|yfkC] to a glutamate exporter (in conjunction with [gene|FC05D5FC95CEDC4B4A04040C86170D185528B9FF|plsC], [gene|22B3039DF4D106F121DBC765F49878C9B324FDB2|accA], or [gene|1DFFEB155028A5C6B4B344769EF7DAAC14983322|accC] mutations that result in reduced phospholipid bisynthesis) [pubmed|33481774]
Protein family
[wiki|MscS (TC 1.A.23) family] (according to UniProt)
Structure
[PDB|3UDC] (from Caldanaerobacter subterraneus subsp. tengcongensis, 36% identity) [pubmed|23074248]
[AF|O35043]
[wiki|Localization]
cell membrane [Pubmed|19252899]
Expression and Regulation
Operons
genes
[gene|62718BBECEB18244B5CC877509679F5F9A0C50CD|yfkA]-[gene|5ACE71EBBDCEB0C534A91DE303FD8069BEFDD6A1|yfkC]
description
[Pubmed|22383849]
Open in new tab

[gene|62718BBECEB18244B5CC877509679F5F9A0C50CD|yfkA]→[gene|5ACE71EBBDCEB0C534A91DE303FD8069BEFDD6A1|yfkC]

2022-11-30 23:48:54

ghost

22

0268bfc04b424f60bea9d4d1f428b25ab4988899

E46E01052075C80D99DCD7C9F6F0FD0CDC2D2DAB

Biological materials
Mutant
MGNA-C271 (yfkC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2269 NBRP B. subtilis, Japan]
1A959 ( ''yfkC''::''tet''), [Pubmed|18310427], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A959&Search=1A959 BGSC]
BKE07940 ([gene|5ACE71EBBDCEB0C534A91DE303FD8069BEFDD6A1|yfkC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGTAAGTGTTTCTTTCATCC,  downstream forward: _UP4_TAAACAAAAAAACTGATTCC
BKK07940 ([gene|5ACE71EBBDCEB0C534A91DE303FD8069BEFDD6A1|yfkC]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGTAAGTGTTTCTTTCATCC,  downstream forward: _UP4_TAAACAAAAAAACTGATTCC
GP2785 (Δ[gene|5ACE71EBBDCEB0C534A91DE303FD8069BEFDD6A1|yfkC]::kan) , available in [wiki|Jörg Stülke]'s lab
GP3131 ([gene|5ACE71EBBDCEB0C534A91DE303FD8069BEFDD6A1|yfkC]-R42W kan [gene|FC05D5FC95CEDC4B4A04040C86170D185528B9FF|plsC]-L48P phleo) , available in [wiki|Jörg Stülke]'s lab
References
Reviews
12626684,22685280,22404681,24607989,17505523,33244613
Original Publications
17665170,18310427,19252899,22383849,23074248,33481774,33568813
Labs working on this gene/protein
[wiki|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]

5ACE71EBBDCEB0C534A91DE303FD8069BEFDD6A1

Page visits: 1633

Time of last update: 2022-12-01 01:35:17

Author of last update: Jstuelk